ID: 1127454682

View in Genome Browser
Species Human (GRCh38)
Location 15:59146018-59146040
Sequence CTCTAAAAATAATAACAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1260
Summary {0: 2, 1: 1, 2: 29, 3: 113, 4: 1115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127454682_1127454686 7 Left 1127454682 15:59146018-59146040 CCTTATTGTTATTATTTTTAGAG 0: 2
1: 1
2: 29
3: 113
4: 1115
Right 1127454686 15:59146048-59146070 CTTGCTATGATGCCCAGGCTGGG 0: 2
1: 110
2: 856
3: 1986
4: 4055
1127454682_1127454687 8 Left 1127454682 15:59146018-59146040 CCTTATTGTTATTATTTTTAGAG 0: 2
1: 1
2: 29
3: 113
4: 1115
Right 1127454687 15:59146049-59146071 TTGCTATGATGCCCAGGCTGGGG 0: 1
1: 30
2: 584
3: 1365
4: 3026
1127454682_1127454685 6 Left 1127454682 15:59146018-59146040 CCTTATTGTTATTATTTTTAGAG 0: 2
1: 1
2: 29
3: 113
4: 1115
Right 1127454685 15:59146047-59146069 TCTTGCTATGATGCCCAGGCTGG 0: 43
1: 5917
2: 38636
3: 101848
4: 210627
1127454682_1127454684 2 Left 1127454682 15:59146018-59146040 CCTTATTGTTATTATTTTTAGAG 0: 2
1: 1
2: 29
3: 113
4: 1115
Right 1127454684 15:59146043-59146065 AAGGTCTTGCTATGATGCCCAGG 0: 2
1: 483
2: 4846
3: 20229
4: 55326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127454682 Original CRISPR CTCTAAAAATAATAACAATA AGG (reversed) Intronic
900048570 1:528448-528470 CTCAAAAAAAAAAAAGAATATGG - Intergenic
900211466 1:1458279-1458301 GTCTTAAAATAATAACTGTATGG - Intronic
901087224 1:6618431-6618453 CTCTACAAAAAATAAAATTACGG - Intronic
901345523 1:8537390-8537412 CTCTAAAAATACTAATATGATGG - Intronic
901465058 1:9416270-9416292 CTTTAAATATAATAACATTTGGG - Intergenic
901835548 1:11921848-11921870 GTCTAAAAATAATAATAATGAGG - Intronic
902316382 1:15622668-15622690 CTCTACCAATAAAAACAAAAGGG - Intronic
902671391 1:17976697-17976719 ATTAAAAAATAATAATAATAAGG - Intergenic
903116140 1:21179485-21179507 CTCAGAAAAGAATAACAATTAGG - Intergenic
903604963 1:24568786-24568808 CTCTAATAACAACAACAAAAAGG - Intronic
903818482 1:26082601-26082623 CTTTAAAAAAAAAAACAAAAAGG + Intergenic
903836428 1:26206174-26206196 CTCTACAAAAAATAAAAAGAAGG + Intergenic
904143771 1:28373589-28373611 CTATAAAAATTATAAAATTATGG - Intronic
904519356 1:31082625-31082647 CTCTACCAAAAATAAAAATAAGG + Intergenic
904645872 1:31965803-31965825 CTCTAAAAAAAAAAAAAATGAGG + Intergenic
904687038 1:32267892-32267914 CTCAAAAAATAATAATAATAAGG + Intronic
905056006 1:35094096-35094118 CTCTAGAAATAATGGAAATAAGG - Intronic
906462338 1:46044484-46044506 TTCTAAGAATAATAAAAAGAAGG - Intronic
906549224 1:46648409-46648431 GTCTCAAAACAATAAAAATAGGG - Intronic
906549655 1:46653333-46653355 CTCTAAGAATAATTTCAAGAAGG + Intronic
906652008 1:47519531-47519553 CTCTAAAAAAAATAGAAAAACGG + Intergenic
906659526 1:47572691-47572713 CTCTAAAAACAGTAAGACTAAGG - Intergenic
907071752 1:51541886-51541908 CTCAAAAAATAAAAAAAAAAAGG - Intergenic
907076231 1:51581654-51581676 CTCTAAAAAAAATAATAATAAGG - Intronic
907099617 1:51817541-51817563 GTCTCAAAATAATAATAATTTGG - Intronic
907825343 1:58011428-58011450 CTCTTAAAATAAGGATAATATGG - Intronic
907963326 1:59304449-59304471 CTATAATAATCATAACAATATGG - Intronic
908199332 1:61778182-61778204 CTCTACAAAAAATAAAAATAAGG - Intronic
908286815 1:62613798-62613820 CACTAAAACTAAATACAATATGG + Intronic
908335005 1:63113365-63113387 ACCTAAAAATAATAACACTTTGG - Intergenic
908653371 1:66360926-66360948 ACCAATAAATAATAACAATAAGG - Intronic
908775609 1:67637207-67637229 CTCTAAATATAATCACATTGGGG - Intergenic
909204260 1:72733481-72733503 TTTTAAAACTAATAACTATATGG + Intergenic
909383563 1:75030187-75030209 CTCTTAAAAAAATAATAAAAAGG + Intergenic
909439030 1:75677591-75677613 CTGGAAAACTAATAACAAAATGG + Intergenic
909833654 1:80226036-80226058 CTGCAAAAATAGTATCAATAAGG - Intergenic
910135101 1:83958506-83958528 TCCTAAAAATTATAAAAATAAGG + Intronic
910341035 1:86187790-86187812 ACTTAAAAATAATAACAAAAAGG - Intergenic
910464468 1:87482279-87482301 CACTAAAAATTATAACATTCTGG - Intergenic
910484139 1:87693268-87693290 CTTTAAAAAAAATAAGAATAGGG + Intergenic
910873713 1:91857772-91857794 CTCCAAAAATAAAAAAAATAGGG + Intronic
910921255 1:92349924-92349946 CTCAAATAATAATAATAATTTGG + Intronic
911030772 1:93485148-93485170 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
911197015 1:95004804-95004826 CTCAAAAAATAAAAATAAAAAGG - Intronic
911448938 1:98039278-98039300 CTCTAAAAATTAAAATAATATGG - Intergenic
911469067 1:98293996-98294018 ATCCAAAAATTATTACAATATGG - Intergenic
911682211 1:100730077-100730099 CTCAAAAAAAAATAACTTTATGG - Intronic
911717631 1:101152507-101152529 GTCTTAAAATAATAACAATTTGG + Intergenic
911879793 1:103222109-103222131 CTCTAAAAATTATGACATTGTGG - Intergenic
912014190 1:105012085-105012107 CTATAAAAATAATAACAATGAGG - Intergenic
912069707 1:105794745-105794767 CTCTAAAAACAAAAGCAAAAGGG + Intergenic
912136442 1:106665007-106665029 CTATATAAATAATAATAAAAGGG + Intergenic
912282497 1:108330738-108330760 CTCTAAAAATAAAAATAAAAAGG + Intergenic
913380424 1:118204317-118204339 CTCTAAAATTTATGACAAAATGG + Intergenic
913544279 1:119851761-119851783 GTCTCAAAACAATAACAAAATGG + Intergenic
913584245 1:120257906-120257928 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
913623936 1:120640434-120640456 CTCTAAAAAAAAAAAAAAAAAGG - Intergenic
914700814 1:150131507-150131529 ATCTCAAAAAAATAAAAATAAGG + Intronic
914843080 1:151264337-151264359 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
915067329 1:153236379-153236401 CTGTTAAGATATTAACAATAGGG + Intergenic
915407922 1:155675622-155675644 CTCTACAAAAAATAAAAATAAGG - Intronic
915480799 1:156183427-156183449 CTCTAAAAAAAAAAAAAAAAAGG - Intergenic
915691259 1:157693515-157693537 CACTAAAACTAATAGGAATAAGG + Intronic
915702678 1:157811130-157811152 CTCTTAAAATAATAGAAATATGG - Intronic
915779576 1:158531539-158531561 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
915871692 1:159567165-159567187 CTCCAAAAATAAAAACACCAGGG + Intergenic
916067505 1:161148270-161148292 CTCAAAAAAAAAAAATAATAAGG - Intergenic
916151969 1:161802348-161802370 CTCTAAAAAAAACAAAAACAAGG - Intronic
916350685 1:163846264-163846286 CTCTAAAAATAATTTTAAAAAGG + Intergenic
916368858 1:164066131-164066153 CTATAATAATAATAATAATAAGG - Intergenic
916477097 1:165180124-165180146 CTCTGAAAATAATCAAAAAATGG + Intergenic
916827333 1:168454970-168454992 CTCTAAAAATATATACTATATGG + Intergenic
917028105 1:170663817-170663839 GACTAAAAATAATAACAAGGGGG - Intronic
917320098 1:173771763-173771785 CTCTAAAAATAAAAATAAAAGGG + Intronic
917321157 1:173783071-173783093 CTTTAAAAATAACAATACTATGG + Intronic
917456168 1:175187831-175187853 ACATACAAATAATAACAATAAGG - Intronic
917732346 1:177887742-177887764 CTTTAAAAAAATTACCAATATGG - Intergenic
917943227 1:179944425-179944447 CTCAAAAAATAAAAATAAAAAGG - Intergenic
917998549 1:180467645-180467667 CTCTAAAAAAAATAAAATAAAGG + Intronic
918173596 1:182022715-182022737 CTTTAAAAAAAATAACAAAAAGG + Intergenic
918457692 1:184741095-184741117 TTTAAAAAATAATAATAATAAGG + Intronic
918551974 1:185753460-185753482 TCTTAAAAATAATAAAAATAGGG - Intronic
918611056 1:186492575-186492597 CTGTAAAAATAGTAACTATTTGG - Intergenic
919015495 1:192028298-192028320 CTGAAAAAATAATAAAATTAAGG - Intergenic
919354740 1:196506849-196506871 GACTAAAAATAATTACATTATGG - Intronic
919605797 1:199681901-199681923 TTCTAAAATTAAAAACAAAAAGG + Intergenic
919647192 1:200106841-200106863 CTCTATGAATAAAAAAAATAGGG - Intronic
919816937 1:201447353-201447375 CTCTCAAAAAAAAAACAAAAAGG + Intergenic
920354865 1:205364512-205364534 GTCAAATAATAATAATAATATGG - Intergenic
920734823 1:208523611-208523633 CTCGAACAATAAGAACAAGATGG - Intergenic
920941705 1:210489527-210489549 CTGCAAAAATAATAACAACGTGG - Intronic
921467979 1:215514060-215514082 CTATAAAAACCAAAACAATATGG + Intergenic
921566937 1:216732829-216732851 CTCTAAAATTAAAAAAAAAAAGG + Intronic
921735631 1:218624502-218624524 CTCTTAAAAAAATAACACCAGGG - Intergenic
921860409 1:220037202-220037224 CTCTAAAAATAAAAATAAAGAGG + Intronic
921981589 1:221264415-221264437 CTCTAAAAACAAGAAGAAAAAGG + Intergenic
921983930 1:221288096-221288118 AAATAAAATTAATAACAATATGG + Intergenic
921998322 1:221446411-221446433 CTATAATAATCATGACAATATGG + Intergenic
922487541 1:225987041-225987063 CTCAAAAAATAATAATAAAAAGG - Intronic
922560951 1:226569289-226569311 TTCTAAGGATAATAATAATAAGG - Intronic
922975573 1:229780798-229780820 CTCTAAAATAAATGAAAATAAGG + Intergenic
923610337 1:235486729-235486751 CACTTAAGATAATAAAAATATGG + Intronic
924348339 1:243093283-243093305 CTCAAAAAAAAAAAAGAATATGG - Intergenic
924576570 1:245285995-245286017 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
1063654938 10:7979039-7979061 CTCTAAAAATAAAAAATAAAAGG + Intronic
1064358638 10:14642934-14642956 CACTAAAAATATGAACATTAAGG - Intronic
1064507634 10:16050487-16050509 CTCAAACAATAATAATAATAAGG - Intergenic
1064533769 10:16336897-16336919 CTACAAAAATAATAATAAAAAGG - Intergenic
1064539346 10:16389767-16389789 CTCAAAAAAAAATAAAAAAATGG - Intergenic
1065014822 10:21452645-21452667 CTGTAAAAATAAATACAAAATGG - Intergenic
1065141112 10:22718996-22719018 CTCTAAAAATAAGAAAGAAAAGG + Intergenic
1065689965 10:28322983-28323005 CTCTACAAAAAAGAAAAATAGGG + Intronic
1065904926 10:30242020-30242042 CTGTAAAAATAAGAACACTGGGG + Intergenic
1066042982 10:31569732-31569754 ATCTCAAAATAATAATAATAGGG + Intergenic
1066086428 10:31976272-31976294 CTCTAAAAAAAAAAAAAAAAGGG + Intergenic
1066207342 10:33202576-33202598 GTCTGAAAATAATGAAAATAAGG + Intronic
1066268598 10:33799968-33799990 TGCAAAAAATAATAATAATAAGG + Intergenic
1066397414 10:35039850-35039872 GTCTCAAAAAAATAAAAATAAGG + Intronic
1066758398 10:38732457-38732479 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1066963258 10:42240237-42240259 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1067171302 10:43908734-43908756 ATCCAAAAATATTAAAAATAAGG + Intergenic
1067842996 10:49696817-49696839 CACTAAAAACATTTACAATACGG - Intronic
1068442335 10:57074117-57074139 CTTTAAAAAGACTAATAATATGG - Intergenic
1068596548 10:58908213-58908235 CCCTAAAATTAATAATAGTAAGG + Intergenic
1069084958 10:64128199-64128221 TTCTAATAATAAAAAGAATATGG - Intergenic
1069193244 10:65517102-65517124 CTAGAAAACAAATAACAATATGG - Intergenic
1069439987 10:68419661-68419683 TTCTCAAAATAAAAACAATGGGG + Intronic
1070142457 10:73748433-73748455 CTCAAAAAATATTAAAAATAAGG - Intronic
1070155525 10:73832308-73832330 CTCAAAAAATAAAAAAAAAAAGG - Intronic
1070178641 10:73994366-73994388 CTCAAAAAATAGTAATAATAAGG - Intergenic
1070438537 10:76417719-76417741 CTTCAAAAATACTAACCATAAGG - Intronic
1070889097 10:79928815-79928837 CTCTAAAAATACAAAAAATTAGG + Intergenic
1071142961 10:82534260-82534282 CTCAAAAAAAAAAAACAAAATGG - Intronic
1071237956 10:83671149-83671171 CTCAAAGAATAAAAAAAATAAGG + Intergenic
1071478980 10:86048787-86048809 ATGTAATAATAATAACATTATGG + Intronic
1072064492 10:91852557-91852579 CTCAAAAAATAAAAATAAAAAGG + Intronic
1072158648 10:92746453-92746475 CTCTAACAACAACAACAAAATGG - Intergenic
1072603399 10:96954803-96954825 CTCTAAAATTAAAAAAAAAATGG - Intronic
1072731251 10:97848810-97848832 CTCTTAAAAAAATAAAAATAAGG - Intergenic
1072930023 10:99654253-99654275 ACTTAAAAATAAGAACAATAAGG + Intergenic
1073117324 10:101098689-101098711 AAATAAAAATAATGACAATAGGG + Intronic
1073157237 10:101356962-101356984 CTCTAAAAATACAAAAAATTAGG + Intronic
1073967397 10:109007161-109007183 ATACAAAAATAATAAAAATACGG - Intergenic
1073999990 10:109361826-109361848 CTTTAAAAAAAATTACAAGAGGG - Intergenic
1074126495 10:110532662-110532684 CTCTAAGAACAAAAACAGTAGGG + Intergenic
1074617876 10:115088416-115088438 CTTTAAAAATAATAATAATAAGG - Intergenic
1074739346 10:116469864-116469886 TTCTAAAAATAAAAATAATCTGG - Intronic
1075034796 10:119055563-119055585 GAATAAAAATAATAATAATATGG + Intronic
1076131295 10:128015808-128015830 CTCTAAAACTAATAAATAAAAGG + Intronic
1076945290 10:133644022-133644044 TTCTACAAATTATTACAATATGG + Intergenic
1076989474 11:263556-263578 CAATGAAAATAATAAAAATATGG + Intergenic
1077387062 11:2274949-2274971 CTCTACAAAAAATAAAAATTTGG - Intergenic
1077613227 11:3658031-3658053 TTCTTAAAAAAATGACAATAAGG + Intronic
1077684076 11:4274498-4274520 CTCTAAAATAAATAATAAAAAGG - Intergenic
1077809945 11:5626880-5626902 CTCAAAAAAAAAAAAAAATATGG + Intronic
1078504175 11:11918032-11918054 GAGTAAAAATAATAACTATATGG + Intronic
1078671017 11:13365136-13365158 CTCTAATAATAACAACTCTATGG - Intronic
1078960495 11:16261920-16261942 CCCTCAAAATAATAAGAAAAGGG - Intronic
1079528164 11:21415580-21415602 CTGTAAAAATAGAAAAAATAGGG - Intronic
1079589589 11:22166029-22166051 CACTATATATAATAACATTATGG - Intergenic
1079608190 11:22396476-22396498 CTCCAAAAATCAAACCAATACGG - Intergenic
1079808580 11:24964602-24964624 CTTTAAAATTAATAACTACAGGG + Intronic
1080567306 11:33522896-33522918 CTCTCAAAAAAAAAAAAATATGG + Intergenic
1080905295 11:36539091-36539113 CTCTAAATACAATAACACTGGGG - Intronic
1081142164 11:39514619-39514641 CTCTAAATATAGTCACATTAGGG - Intergenic
1081200681 11:40211490-40211512 ATCTAAAAATGTAAACAATAAGG + Intronic
1081444022 11:43112399-43112421 CACAAATAATAATAACAATAAGG - Intergenic
1081460287 11:43266505-43266527 CTCTATAAATAAATAAAATAAGG + Intergenic
1082195735 11:49302760-49302782 CTATAGTAATAAAAACAATATGG - Intergenic
1082618538 11:55393073-55393095 CTCTAAAAATATTCCCAGTAAGG - Intergenic
1083084693 11:60130537-60130559 CTCTGAAAATAGTACAAATAAGG + Intergenic
1083221543 11:61256151-61256173 CTCAAAAAATAATAATAATAAGG + Intergenic
1083246532 11:61432249-61432271 CTCAAAAAATAAATAAAATAGGG + Intronic
1083348432 11:62010406-62010428 CTCTAAAAAAATTAAAAACATGG + Intergenic
1083475959 11:62915795-62915817 TAATAATAATAATAACAATAAGG - Intronic
1083555967 11:63628446-63628468 CTCAAAAAAAATTTACAATAGGG - Exonic
1083666854 11:64280015-64280037 CTCTAAAATTAATAATAATTTGG + Intronic
1083778145 11:64904243-64904265 CTCAAAAAGAAATAATAATAAGG + Intronic
1083915216 11:65738500-65738522 CTTTAAAATTTACAACAATAGGG - Intergenic
1083946125 11:65924065-65924087 CTCTAAAAAAAAAAAAAAAAAGG - Intergenic
1084309614 11:68309231-68309253 CTCTAAAAAAAAGAAAAAAAAGG - Intergenic
1085131593 11:74044035-74044057 CTCTATAAAAAATAATAACATGG + Intronic
1085663098 11:78388042-78388064 GTCTAAAAAAAAAAAAAATACGG - Intronic
1085672240 11:78478246-78478268 CTATAAAAATAATTAGAACATGG + Intronic
1085817407 11:79754672-79754694 CTTTAAAAATACTAATATTAAGG - Intergenic
1085840550 11:80006995-80007017 CTTTTAATATAATAATAATATGG - Intergenic
1086251057 11:84814819-84814841 GTATTATAATAATAACAATATGG + Intronic
1086407133 11:86507974-86507996 CTCAAAAAAAAAAAAAAATATGG + Intronic
1086623031 11:88911160-88911182 ATCTAAAAACAATAAAAAAAGGG + Intronic
1086660105 11:89405476-89405498 CTATAGTAATAAAAACAATATGG + Intronic
1086784042 11:90943609-90943631 TTCTGAAAATAATAATACTAAGG - Intergenic
1086992248 11:93316416-93316438 TTTAAAAAATAACAACAATAAGG + Intergenic
1087232912 11:95685818-95685840 TAATAATAATAATAACAATATGG - Intergenic
1087985439 11:104672754-104672776 CTTTAAAAATATTAACTATAGGG - Intergenic
1088278880 11:108117147-108117169 CTCTACAAAAAATAAAAATTAGG + Intergenic
1088638237 11:111845301-111845323 CTCAAATAAAAATAAAAATAAGG + Intronic
1088763222 11:112951504-112951526 CTATAACAGTAATAATAATAAGG - Intergenic
1088900882 11:114116118-114116140 CTCTAGAAGAAATAAGAATATGG + Intronic
1088946276 11:114516569-114516591 CAATAATAATAATAATAATAAGG - Intergenic
1089325927 11:117656959-117656981 CTCTAAGAGAAATAAAAATAAGG + Intronic
1090039309 11:123276418-123276440 CTCAAAAAAAAACAACAACATGG + Intergenic
1090142759 11:124282512-124282534 CTTTGAAATTAATAAAAATAGGG + Intergenic
1090542251 11:127720461-127720483 TTGTAAAAAAATTAACAATATGG + Intergenic
1090587908 11:128234102-128234124 CTCAAAAAATAAAAAAAAAAAGG + Intergenic
1090880346 11:130827264-130827286 CACAAAAAATAATAATAATATGG - Intergenic
1091245526 11:134091192-134091214 CTCTATAAAAAATAAAAATAAGG + Intronic
1091465155 12:677737-677759 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
1091507856 12:1091187-1091209 ATCTATAAATAATAAAAATGGGG - Intronic
1091855226 12:3733969-3733991 CTCAAAAAAAAAAAAAAATAAGG - Intronic
1091900185 12:4138234-4138256 CCAAAAAAATAATAATAATAAGG + Intergenic
1092210902 12:6645958-6645980 CTCAAAAAAAAACAACAACAGGG - Intronic
1092363678 12:7859390-7859412 CTCAAAAAATAAAAAAAAAAAGG + Intronic
1092467940 12:8750977-8750999 TTTTTAAAATATTAACAATAAGG - Intronic
1092477872 12:8834495-8834517 CCCTGAAAAGAATAACAATGGGG - Intronic
1092661052 12:10738991-10739013 CTCAAAAAATAATAATAAGAGGG - Intergenic
1093188695 12:16050577-16050599 CTCTAATAATAATAATAATGGGG + Intergenic
1094676460 12:32625584-32625606 TTCAAAAAATAATAATAAAAGGG + Intronic
1095445040 12:42274324-42274346 CTCTAACAAAAAGAAAAATAGGG - Intronic
1095482791 12:42653024-42653046 ATAAAAAAATAATAATAATAAGG - Intergenic
1095841206 12:46695184-46695206 CTATAGAAATATTAACCATATGG + Intergenic
1095973664 12:47924220-47924242 TTCTAAAAAAAAAAAAAATATGG - Intronic
1096222993 12:49843760-49843782 ATATAAAAAGAATAATAATACGG - Intergenic
1096261316 12:50093780-50093802 CTCTAAAAATAAAAAAAATTCGG - Intronic
1096381622 12:51163287-51163309 CTTAAAAAATAATAGTAATAAGG + Intronic
1096597309 12:52704372-52704394 ATCTAAAAATAAAAAAAATTTGG - Intergenic
1097201885 12:57286057-57286079 CTCTACAAATAAAAATAATTAGG + Intronic
1097396978 12:59087139-59087161 CTCCAATCATAATAAAAATATGG - Intergenic
1097453089 12:59760216-59760238 CTCTAAAAATTATACCATTTGGG + Intronic
1097534096 12:60843783-60843805 CTCTAGAAAAAATTATAATATGG - Intergenic
1097539189 12:60915328-60915350 TTCTAAAAATCCTGACAATAAGG - Intergenic
1097767135 12:63538880-63538902 CTCTAAAAATAAAAATAACACGG - Intergenic
1098002068 12:65955331-65955353 CTCTAATAATAATAATAATCTGG - Intronic
1098191670 12:67955638-67955660 ATCTAAAAATAAGTACAAGAAGG + Intergenic
1098792462 12:74841320-74841342 CTTTAAAAAGTATAACCATATGG - Intergenic
1099115495 12:78619352-78619374 CTCCAAATATCATAACATTAGGG + Intergenic
1099199045 12:79654299-79654321 GACTAAAAATAGTAACAATGAGG + Intronic
1099595507 12:84658619-84658641 AGCTAAAAATAATAATAAGATGG + Intergenic
1099819514 12:87692722-87692744 CCCTAAAAATAATTACAATTTGG + Intergenic
1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG + Intronic
1100694142 12:97073206-97073228 CTCTAAAAAAAAATAGAATAAGG - Intergenic
1100826783 12:98482274-98482296 CTCTAAAAATAAAAATATAAAGG + Intergenic
1101025574 12:100601585-100601607 CTAGAAACATAAAAACAATATGG - Intronic
1101146330 12:101844259-101844281 CTCTAAAAAAAAAAAAAAGAAGG + Intergenic
1102245113 12:111350956-111350978 CTCTAAAAAAAAAAAAAAAATGG + Intergenic
1102638840 12:114348360-114348382 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
1102851694 12:116252534-116252556 GTCTCAAAATAATAATAAAAGGG + Intronic
1102910719 12:116711780-116711802 CTCTACAAAAAATAAAAAAAAGG - Exonic
1103137480 12:118519975-118519997 CTCAAAAAAAAAAAAAAATATGG - Intergenic
1103307205 12:119974502-119974524 CTCAAAAAAAAAAAAAAATAGGG - Intergenic
1103359358 12:120344705-120344727 TATTAAAAATAATAATAATAGGG + Intronic
1103420940 12:120781876-120781898 CTCTTTAAAAAGTAACAATAAGG - Intronic
1104407457 12:128530038-128530060 CTCTAAAAATAAAACCACTCAGG - Intronic
1104699542 12:130891626-130891648 CTCTACTAAAAATAAAAATATGG + Intergenic
1105048948 12:133030537-133030559 CTCTAAAAGGAATGAAAATATGG + Intergenic
1105463971 13:20619977-20619999 CTCAAAAAATAATATTCATATGG - Intronic
1105507529 13:21023262-21023284 CTCTAAAAAGAAAAAAAAAAAGG - Intronic
1105582495 13:21712383-21712405 CTTTAAAAATAATAACAATGTGG + Intergenic
1106523228 13:30516912-30516934 GTCTCAAAATAATAATAATAAGG + Intronic
1106778326 13:33029931-33029953 CTTTAAAAAAAAAAAAAATAGGG - Intronic
1106900003 13:34345602-34345624 CTCTAAAAATAAAAGCTAAAAGG + Intergenic
1106982400 13:35303262-35303284 CTCTTAAAATAATACTACTACGG - Intronic
1107190027 13:37570812-37570834 CCCCAAAAATCATATCAATAGGG + Intronic
1107275648 13:38675962-38675984 ATCTAAAAATAAGTACAAGAAGG - Intergenic
1107608556 13:42088337-42088359 CACTAGAAATAATTAGAATATGG + Intronic
1107727813 13:43317530-43317552 TAATAAAAATAATAATAATAGGG - Intronic
1107845173 13:44505259-44505281 CTCCAAAAAAAATTAAAATAAGG + Intronic
1108236615 13:48414532-48414554 TTAAAAAAATAATAACAGTAAGG - Intronic
1108399977 13:50030971-50030993 CTATAAAAATAACAAAAAAACGG + Intergenic
1108568617 13:51727332-51727354 CTCTGAAAATAAGAACAATATGG - Intronic
1108831830 13:54488660-54488682 CAATAATAATAATAATAATAAGG + Intergenic
1108900079 13:55391723-55391745 CTCTAAAAACAATCATATTAGGG - Intergenic
1109670131 13:65594195-65594217 TTCTAAAAATGAAAAAAATAAGG + Intergenic
1109694691 13:65938857-65938879 ATCGACAAATATTAACAATATGG - Intergenic
1109818006 13:67612960-67612982 CTCTCAAAATATGAACATTAAGG + Intergenic
1109912978 13:68941098-68941120 CCATAATAATAATAATAATAGGG + Intergenic
1110089044 13:71421875-71421897 CTATAAAAATCAAAACAGTATGG - Intergenic
1110335417 13:74324323-74324345 CTCTAAGAATTATGACAAGATGG + Intergenic
1110390704 13:74970376-74970398 CTTCAAAAATAATAACAGAAAGG + Intergenic
1110434184 13:75460755-75460777 CACTAAAAATAAAAAAAAAATGG + Intronic
1110565788 13:76956498-76956520 TAATAAAAATAATAATAATAAGG - Intronic
1110721179 13:78764175-78764197 CTTTAAAATAAAAAACAATATGG - Intergenic
1110763603 13:79256802-79256824 CTCTAAAAGAAATAATAAAATGG - Intergenic
1110829533 13:80014449-80014471 CCCCCAAAATGATAACAATATGG - Intergenic
1110894989 13:80738428-80738450 CTATAGTAATAAAAACAATATGG + Intergenic
1111018414 13:82412178-82412200 CACTAAAAATAATACCTGTAGGG - Intergenic
1111205437 13:85002380-85002402 TGCCAAAAATAATAACATTATGG - Intergenic
1111269197 13:85858288-85858310 CTTTATAAAAAATAATAATATGG - Intergenic
1111314181 13:86530859-86530881 ATATAAAAATTATAAGAATAAGG - Intergenic
1111402111 13:87752111-87752133 CTTTAAAAATGATAATAATTTGG - Intergenic
1111477820 13:88776161-88776183 TTCTAAAAATAATAATTTTAGGG - Intergenic
1111744348 13:92247828-92247850 CTCACCAAATAATAACAATATGG + Intronic
1111785811 13:92785273-92785295 CTCAAAAAATAATAAGAAGAAGG + Intronic
1112300838 13:98228358-98228380 CTCAAAAAATAAAAAGAAAAAGG + Intronic
1112641768 13:101283317-101283339 GGATAACAATAATAACAATAAGG - Intronic
1112788122 13:102974080-102974102 ATATAAAAATAATAATAATGTGG - Intergenic
1112879562 13:104089241-104089263 GTTTAAAAATAATAAGAAAATGG + Intergenic
1112976910 13:105331482-105331504 TTATAAAAATAATAACTTTAAGG - Intergenic
1113007023 13:105717611-105717633 ATCTAAAAATAATTAGAGTAAGG - Intergenic
1113190034 13:107734529-107734551 CTTTAAAAATAATAACTCTTAGG - Intronic
1113390918 13:109895683-109895705 GTCTAAATATGATAAAAATATGG + Intergenic
1114369239 14:22067313-22067335 CTCCATAAATAATAATAATCTGG - Intergenic
1114861971 14:26534781-26534803 CCCTAAATATAATCACAAGAGGG + Intronic
1114920118 14:27315882-27315904 CCATAAAAATAATACAAATATGG - Intergenic
1115031375 14:28799140-28799162 TTCTAATAAGAATAAAAATAAGG - Intronic
1115558917 14:34565515-34565537 GTCTAAAAATAAAAACAAAGAGG - Intronic
1115603617 14:34979102-34979124 CTTTAAAAAAAGTAAAAATAGGG + Intergenic
1115611356 14:35051415-35051437 GTCTCAAAAAAATAAAAATAAGG - Intronic
1115644119 14:35355500-35355522 CTCTAAAAAAAATAACAGGCTGG + Intergenic
1115712504 14:36066478-36066500 ATCTGTAAATAATAATAATAAGG + Intergenic
1116675376 14:47900068-47900090 CCTTAAAAATATTAACATTACGG - Intergenic
1117128939 14:52664963-52664985 CACTAAAAATAACAACAACAGGG + Intronic
1117143467 14:52812771-52812793 TGATAATAATAATAACAATAAGG + Intergenic
1117761678 14:59035477-59035499 TTGTAATAATAATAACAAAATGG - Intergenic
1117901007 14:60533300-60533322 CTCTTAAAATAATAAAATTTGGG - Intergenic
1118073928 14:62277674-62277696 CACTAACAAAAATAATAATAAGG - Intergenic
1118079902 14:62346895-62346917 GTCAGAAAATAATAATAATAAGG - Intergenic
1118114202 14:62756785-62756807 ATCTAAAAATTAAAACAAAATGG + Intronic
1118406751 14:65431916-65431938 ATTTAAAAATAATAATAATAAGG - Intronic
1118553787 14:66989595-66989617 TTCTAAAAATATTAAATATAAGG + Intronic
1118621334 14:67617175-67617197 CTCTAAAAAAAATAAAAATAGGG - Intergenic
1119794474 14:77383237-77383259 TTAAAAAAATAATAATAATAAGG + Intronic
1119983537 14:79109896-79109918 TTTAAAAAATAATAATAATAAGG + Intronic
1120579074 14:86223917-86223939 CTCTAAAAATTTCAAAAATAGGG + Intergenic
1120614772 14:86689771-86689793 TTGTAAAAATAAGAAAAATAAGG - Intergenic
1121193660 14:92051046-92051068 GTCTAAAATTAATAAGAAAATGG - Exonic
1121349591 14:93162715-93162737 CTCTAAAAAAATTAAAAATTGGG + Intergenic
1121475212 14:94194257-94194279 CTCTAAAACTAAAAAGAATTGGG - Intronic
1121560625 14:94872785-94872807 CTCCAAGAATAATAAAAACAAGG + Intergenic
1122514392 14:102297055-102297077 CTCAAAAAATAATAATAAATAGG + Intronic
1123003705 14:105311252-105311274 CTCAAAAAATAAAAATAAAAAGG - Exonic
1202918627 14_KI270723v1_random:9348-9370 CTCTACAAATTATTACAATATGG + Intergenic
1202925996 14_KI270724v1_random:25221-25243 CTCTACAAATTATTACAGTATGG - Intergenic
1123339461 15:18979693-18979715 CTCTTAAGATAATGACATTAAGG + Intergenic
1123441804 15:20297173-20297195 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1124266157 15:28236253-28236275 TGATAAAAATAATAATAATAAGG - Intronic
1124311993 15:28634436-28634458 TGATAAAAATAATAATAATAAGG + Intergenic
1124398418 15:29327050-29327072 CTCAAAAAATTATATCAAAAGGG + Intronic
1124406316 15:29395454-29395476 TTATAAAAATAATAGCCATATGG - Intronic
1124627334 15:31315815-31315837 GTCTAAAAAAAAAAACAAAATGG - Intergenic
1125015604 15:34931297-34931319 ATCTAAAAATAATAAAGATTTGG - Intronic
1125064374 15:35464290-35464312 CTCAAAAAAAAAAAAAAATAAGG + Intronic
1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG + Intergenic
1125230573 15:37450651-37450673 CTCTAAAAAAAATAATAGTCTGG + Intergenic
1125304957 15:38301050-38301072 CTCGAAAAATTATAAGAACAAGG + Intronic
1125550818 15:40543137-40543159 GTCTAAAAAAAAAAACAAAATGG + Intronic
1125556129 15:40586545-40586567 GTTTAAAAATAACAATAATAAGG - Intergenic
1125743372 15:41982984-41983006 CTATAAAAATAATGAGACTAGGG + Exonic
1125854322 15:42934543-42934565 CTAAAAAAATAATAATAATAAGG + Intergenic
1126135495 15:45386384-45386406 TTCTAAAAATAATAGCGATTAGG - Intronic
1126207382 15:46060689-46060711 TTCTAGAAATAATAACCAGAGGG + Intergenic
1126213035 15:46121315-46121337 CTCTCAAAATAATAACAATGGGG - Intergenic
1126244061 15:46482824-46482846 CTTTGAAAAGAATAACAAAATGG - Intergenic
1126469900 15:48997867-48997889 CTCAAAAAAAAATAATAAGATGG + Intronic
1126498312 15:49317038-49317060 CTTTACAAAGTATAACAATATGG + Intronic
1126960536 15:53988929-53988951 CTTTAAAAATACTGACAATATGG - Intergenic
1127227490 15:56948120-56948142 CTCAAAAAATAAAAAAAAAAAGG - Intronic
1127410544 15:58701803-58701825 TATTAAAAATAATAATAATAAGG + Intronic
1127454682 15:59146018-59146040 CTCTAAAAATAATAACAATAAGG - Intronic
1127717274 15:61661442-61661464 CACAAAAAATAATAATAATAAGG + Intergenic
1127853122 15:62932887-62932909 CTCTAAAAATAAAATAAACAAGG - Intergenic
1127881325 15:63161023-63161045 CTCTAAACACAATAGCAAAAGGG - Intergenic
1128069817 15:64788108-64788130 CTTAAAAAATAACAAAAATAAGG - Intergenic
1128077784 15:64838925-64838947 CACTTAAAAAAATAATAATATGG - Intergenic
1128086560 15:64890858-64890880 CTCTAAAAATTTTAAAAATTAGG - Intronic
1128591578 15:68902302-68902324 CTCCAAAAATAAAAAAAAAAGGG + Intronic
1128939323 15:71774774-71774796 CTCTGAAAAAAAAAAAAATAGGG + Intronic
1129709713 15:77814448-77814470 CTTGGAAAATAATAATAATAAGG + Intronic
1130271427 15:82451854-82451876 CTCCAAAAATAAAAATAAAAAGG - Intergenic
1130488907 15:84415593-84415615 CTCCAAAAATAAAAATAAAAAGG + Intergenic
1130686768 15:86044466-86044488 CTCTAAAACAAATTATAATAAGG - Intergenic
1130770469 15:86918535-86918557 CTCAAAAAATAAAAAAAAAAAGG + Intronic
1130776221 15:86986530-86986552 CTACAAAAATAATAGCAAAAAGG + Intronic
1130787802 15:87119568-87119590 CTGTTAAAATATAAACAATAAGG + Intergenic
1130974744 15:88765148-88765170 CTATAAAAAAAATAATAATTGGG + Intergenic
1131127814 15:89870057-89870079 ATTTTAAAATCATAACAATAAGG + Intronic
1131227003 15:90632605-90632627 GTCTCAAAATAATAATAACATGG - Intronic
1131277715 15:90995765-90995787 TTCTGAAAATAAGAAAAATATGG - Intergenic
1131349640 15:91686989-91687011 CTTTAAAAAGAATAATAAAATGG + Intergenic
1131382588 15:91976027-91976049 CATTAAAAATAATAATAATAAGG - Intronic
1131429610 15:92376307-92376329 CTCTAAAAATAATCACAACATGG + Intergenic
1131452777 15:92559805-92559827 CTCTAAAAATAAAATCAAATGGG + Intergenic
1131589547 15:93733308-93733330 TTTGAAAAATAATAGCAATAAGG - Intergenic
1132529215 16:436768-436790 CTCTACGAAAAATAAAAATAAGG - Intronic
1133072839 16:3257823-3257845 ATCTAAAAATAAAAAAATTAGGG - Intergenic
1133265262 16:4579610-4579632 CTCAAAAAAAAAAAAAAATAAGG - Intronic
1133327762 16:4952567-4952589 CTCAAAAAAAAAAAAAAATAGGG - Intronic
1133351366 16:5102860-5102882 GTCTAAAAAAAATAACCACAAGG - Intergenic
1133380123 16:5322792-5322814 CTCTCAAAATAAGTAGAATAAGG - Intergenic
1133885011 16:9819025-9819047 CTCTATAAAAAATAACTTTATGG + Intronic
1133941551 16:10313259-10313281 TTCTAAAAATAAACACAAAAAGG + Intergenic
1133993799 16:10731288-10731310 CTCAAAAAAAAATAATAAAAGGG + Intergenic
1134175390 16:12002011-12002033 CTTTAAAAAAAAAAAAAATAGGG - Intronic
1134639507 16:15818729-15818751 CTCCAAAAATAAAAAGAATCGGG - Intronic
1134673073 16:16070208-16070230 ATCTACAAAAAATAACAAAATGG + Intronic
1135018865 16:18947022-18947044 CTCTATTAAAAATAATAATAAGG + Intergenic
1135104989 16:19641361-19641383 CTCTAAAAATAAAAACAGGCCGG - Intronic
1135582830 16:23642481-23642503 CTCAAAAAATAAAAACACAAAGG - Intronic
1135904619 16:26499750-26499772 CTCTAAAATAAATGACAATTTGG + Intergenic
1136037560 16:27551584-27551606 CTTTAAAAATAATAAAAATTGGG + Intronic
1136162634 16:28430584-28430606 CTCAAAAAATAATAATAATATGG - Intergenic
1136169531 16:28480119-28480141 CTCTACAAAAAACAACAACAGGG - Intronic
1136200332 16:28684404-28684426 CTCAAAAAATAATAATAATATGG + Intergenic
1136216680 16:28798597-28798619 CTCAAAAAATAATAATAATATGG + Intergenic
1136491486 16:30611174-30611196 GTCTCAAAAAAATAAAAATAAGG - Intronic
1136668009 16:31831068-31831090 ATCTAAATATAAAATCAATAAGG + Intergenic
1136719402 16:32308338-32308360 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1136724429 16:32346738-32346760 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1136837774 16:33514618-33514640 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1136842755 16:33552779-33552801 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1137648621 16:50098353-50098375 CTTTAAAAATAATAATAAATAGG + Intronic
1137769125 16:51001941-51001963 TTGTCAAAATAATAACAATTTGG - Intergenic
1137775005 16:51047076-51047098 CTCAAAAAATAAGAAGAAGAAGG + Intergenic
1137878958 16:52026443-52026465 TTCTAAAAATAATGATAAAAAGG + Exonic
1137980694 16:53066935-53066957 TTTAAAAAATAATAATAATAGGG - Intronic
1138032987 16:53575619-53575641 CTCTACAAAAAATAAAAATAAGG - Intergenic
1138070350 16:53987120-53987142 CTCTAAAAAAATTAAAAAAAAGG + Intronic
1138173666 16:54876538-54876560 CTGTAAAAATAGGAATAATAGGG + Intergenic
1138253243 16:55525019-55525041 CTTTATAACTAATAACAATAAGG - Intronic
1138253437 16:55527810-55527832 ATCTAAAAACTGTAACAATACGG + Intronic
1139177327 16:64704781-64704803 CTCTAAAATTAAGAAAAAAAAGG + Intergenic
1139196559 16:64925657-64925679 CTGTAAAATTAATCAAAATAGGG - Intergenic
1139335304 16:66227027-66227049 GTTTAAAAATAATCACCATAAGG - Intergenic
1139622110 16:68153913-68153935 CTCTTAAAAAAATAATAATGTGG - Intronic
1139639277 16:68279167-68279189 CTCTAAAAAAAAAAAAAATTAGG + Intronic
1139705098 16:68735947-68735969 GGGTAAAAATAGTAACAATAGGG - Intergenic
1139739969 16:69026861-69026883 CTCAAAAAATAAAAAAAAGAAGG - Intronic
1139751319 16:69110402-69110424 TTTAAAAAATAATAATAATAAGG - Intronic
1139861128 16:70022353-70022375 CACAAAAAATAATAATAATGTGG - Intergenic
1139903197 16:70344409-70344431 CTCAAAAAATAATAATAAAAAGG - Intronic
1140398758 16:74652388-74652410 CTTTAAAGATACTGACAATATGG - Intronic
1141098268 16:81178336-81178358 CTCTAAAAAGAAAAAAAATTAGG - Intergenic
1141275539 16:82584605-82584627 ATGTAAAAATAATAATAATGAGG + Intergenic
1141752605 16:85968984-85969006 CTCAAATAATAATAATAATAAGG + Intergenic
1142026091 16:87814568-87814590 CTCAAAAAAAAAAAAAAATAGGG - Intergenic
1142296280 16:89224616-89224638 CTCAAAAAATAATAAAAAAAAGG + Intronic
1203002001 16_KI270728v1_random:171017-171039 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1203007029 16_KI270728v1_random:209431-209453 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1203133605 16_KI270728v1_random:1707423-1707445 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1203147954 16_KI270728v1_random:1814904-1814926 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1203152920 16_KI270728v1_random:1853077-1853099 GTCTCAAAAAAATAAAAATAAGG + Intergenic
1142784638 17:2211351-2211373 CCCTAAAGAAAATAACAAAAAGG + Intronic
1142922943 17:3207110-3207132 CTCTAAAAACAAAAAAAAAAAGG + Intergenic
1143047252 17:4091774-4091796 CTCAAAAAAATATAAAAATAAGG + Intronic
1143556261 17:7662922-7662944 CATTCAAAATAATGACAATAAGG - Intronic
1143643864 17:8216870-8216892 ATTTCAAAATAATAATAATAAGG - Intergenic
1144806959 17:17974369-17974391 CTCAAAAAATAAAAAAAATAAGG - Intronic
1145055031 17:19696989-19697011 CTCTTAAGATAATGACATTAAGG + Intronic
1145064289 17:19751683-19751705 CTCTACAAAAAATAAAAAAAAGG + Intergenic
1145284722 17:21496723-21496745 CTCTAAAAATTATAATGAAATGG - Intergenic
1145727227 17:27141720-27141742 CCATAAAAATAATAATCATATGG + Intergenic
1145805696 17:27727796-27727818 TTCTAAAAAAAATAAAAATAAGG + Intergenic
1146038913 17:29432773-29432795 CTCTAAAAAAAAAAAAAATTTGG - Intronic
1146198019 17:30829706-30829728 CAATAAAAATGATAATAATAAGG + Intergenic
1146340920 17:32019226-32019248 CTGTATAAATGATAACAATGGGG - Intronic
1146400908 17:32499330-32499352 CTCTAAAAATAAAATTAAAAAGG + Intronic
1146592056 17:34135881-34135903 TTCTAAAAAAAATAATAATGTGG + Intronic
1146619001 17:34382116-34382138 CTCAAAAAAAAAGAACAAAAGGG - Intergenic
1146964976 17:37018886-37018908 CTCTAAAACTACAATCAATAAGG - Intronic
1147199522 17:38790873-38790895 CTAAAAAAATAATAATAATAGGG - Intronic
1147444771 17:40468180-40468202 CTCTCAAAAAAATAAAAAGAAGG - Intergenic
1147506115 17:41019210-41019232 CTATAATAATAATAGAAATAAGG - Intronic
1147634068 17:41952065-41952087 CTCTACAAAAAATAAAAATTAGG + Intronic
1147868704 17:43572010-43572032 GTCTCAAAAAAATAAAAATAGGG - Intronic
1147954803 17:44126659-44126681 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
1149165175 17:53742588-53742610 TGCTATAAATAATAATAATACGG - Intergenic
1149198017 17:54147000-54147022 CTATAAAGATAATAAAAAGAAGG - Intergenic
1149297870 17:55276892-55276914 TTTTCAAAATAATAAAAATAAGG - Intronic
1149407281 17:56366592-56366614 CACTAAAAATACTAAAAGTATGG - Intronic
1149725791 17:58892732-58892754 CTCTTAAAACAATAAGAAAATGG + Intronic
1149812640 17:59692311-59692333 CTCAAAAAATAATAATAAACTGG + Intronic
1150530644 17:65977772-65977794 CTTTAAAAATAAAAATAAAAAGG + Intronic
1150872973 17:68935083-68935105 CTCTAAAAAAAAAAAAAAAAAGG - Intronic
1150967139 17:69984226-69984248 CTCTAAAAATAAAAAATAGAAGG + Intergenic
1151014067 17:70533862-70533884 CTATAAAAATGATGACAATTTGG - Intergenic
1151340659 17:73468823-73468845 CTCAAAAAAAAATAAAAATAAGG - Intronic
1151609920 17:75166173-75166195 ATTTAAAAATAATAAAAATTTGG + Intronic
1151669012 17:75561618-75561640 CTCTAAAAAGATTAAAAATTAGG + Intronic
1151746922 17:76016611-76016633 GTCTCAAAATAATAATAATATGG + Intronic
1151798332 17:76361967-76361989 TTCTAAAAATAATACCAACTTGG + Intronic
1152131672 17:78480871-78480893 GTCTCAAAAAAATAATAATAAGG - Intronic
1203161236 17_GL000205v2_random:52464-52486 CTACAAAAATAAAAACAATATGG - Intergenic
1153236310 18:2991709-2991731 CTCAAAAAATAATAATAATAAGG + Intronic
1153335026 18:3914752-3914774 CTCAAAAAATAATAATAACATGG - Intronic
1153459057 18:5313659-5313681 CTCTAAATATAATAGCTATCTGG + Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153821720 18:8837812-8837834 CTCTAAAAATAAATAAAACAAGG - Intergenic
1153878021 18:9393556-9393578 CTCTAAAAAAAATAAACAGATGG - Intronic
1153916007 18:9745096-9745118 CACTAAAATTAAAAACAAAATGG + Intronic
1154471978 18:14712459-14712481 CTCCAAAAATTAGAACACTAAGG + Intergenic
1155114446 18:22750913-22750935 CTTTGGAAAGAATAACAATAAGG + Intergenic
1155255813 18:23997248-23997270 CTCTAAAAAGAAAAATAAAAAGG + Intronic
1155879636 18:31129034-31129056 GTCTATAAACAATAACAGTATGG - Intergenic
1156325247 18:36068799-36068821 TTGTAAAAATGAAAACAATATGG - Intergenic
1156740712 18:40324393-40324415 TAATAAAAATAATAATAATAAGG - Intergenic
1157155907 18:45265798-45265820 TTCTAAAAACAGTAACAACAGGG - Intronic
1157232553 18:45932261-45932283 CTTTTAAAATATTAACTATAAGG + Intronic
1157272916 18:46290363-46290385 CTCTACAAAAAATAAAAAGATGG + Intergenic
1157709078 18:49836281-49836303 CTTTAAAACTAATTGCAATATGG - Intronic
1157828638 18:50835920-50835942 ATCTAAATAAAATACCAATATGG - Intergenic
1158244823 18:55420298-55420320 TTCTAGAAATAAAAACAAGAAGG + Intronic
1158258007 18:55574914-55574936 CTGAAAAAATAATAAGAACATGG + Intronic
1158303883 18:56083349-56083371 CTGTAAAAATATTAACTGTACGG - Intergenic
1158329431 18:56345179-56345201 GTCCAAAAGTAATAACAATTAGG + Intergenic
1158578998 18:58665206-58665228 GTCTCAAAATAATAATAATAGGG - Intergenic
1158915140 18:62117552-62117574 CTCTAAAAAGAATCTAAATATGG + Intronic
1159029459 18:63216068-63216090 CTATCAACATATTAACAATAGGG + Intronic
1159093260 18:63872795-63872817 ATCCAAAAATAAGAACAATGGGG + Intronic
1159650801 18:70975176-70975198 TTCTATAAAGAATAACTATAGGG + Intergenic
1159781019 18:72660312-72660334 CTCAAATAATAATAATAACAGGG + Intergenic
1160953808 19:1680303-1680325 CTCTAAAAAAAAAAAAAAGAAGG - Intergenic
1161100934 19:2421585-2421607 CTCTAAAAATAATAACAATAAGG - Intronic
1161207529 19:3049112-3049134 CTCTACAAAAAATAAAAATAAGG - Intergenic
1161239084 19:3211769-3211791 CTCTAAAAAAAAAAAAAAAAAGG - Intergenic
1161291337 19:3494976-3494998 CTCTAAAAAAAAAAAAAAAATGG - Intronic
1161362959 19:3861623-3861645 CTCAAAAAATAATTGAAATAGGG + Intronic
1161487799 19:4544930-4544952 ATTAAAAAATAATAAAAATAAGG - Intronic
1161569935 19:5024946-5024968 CTCAAAAAACAAAAACAAAAAGG + Intronic
1162311486 19:9910214-9910236 TATTAATAATAATAACAATAAGG + Intronic
1162864378 19:13533244-13533266 CTCTTAAAAAAATAAAAACAAGG - Intronic
1162890149 19:13726895-13726917 CTTTAAAAATAATAATAATAGGG + Intergenic
1162949929 19:14065081-14065103 CTCAAATAATAATAATAATAAGG + Intergenic
1163307989 19:16494360-16494382 CTCAAAAAAAAAGAAAAATATGG - Intronic
1163892613 19:20030267-20030289 CAATAGAAATAATAACTATAGGG + Intronic
1164005342 19:21143176-21143198 GTCAAAAAATAATTAAAATACGG - Intronic
1164164023 19:22651841-22651863 GTTTAAAAATAATAATAATTAGG + Intronic
1164469243 19:28514823-28514845 CATTAAAAATAATAACTTTAAGG + Intergenic
1164704257 19:30308256-30308278 CCCTAAAAATACTCACAATGTGG + Intronic
1164710208 19:30351575-30351597 TTCTTAAAATCATAACAAGAAGG - Intronic
1164819115 19:31231048-31231070 GACTAAAAATAATAATAATGAGG + Intergenic
1165312358 19:35036435-35036457 TTGCAAAAATAATAATAATAAGG - Intronic
1165340504 19:35208462-35208484 CTCAAAAAAAAAAAGCAATAAGG - Intergenic
1165375589 19:35439545-35439567 CCCTAAACATAATCACAAAAAGG - Intergenic
1165781989 19:38440290-38440312 CTCTAAAAATAAAAATAAATGGG + Intronic
1166440893 19:42814282-42814304 CTTTAAAAATAATTAAAATTAGG + Intronic
1166460372 19:42982893-42982915 CTTTAAAAATAATTAAAATTAGG + Intronic
1166477667 19:43142871-43142893 CTTTAAAAATAATTAAAATTAGG + Intronic
1167021319 19:46878321-46878343 CTCTCAAAAAAATAAAAATTAGG - Intergenic
1167151475 19:47712838-47712860 CTCTAAAAAAAATAATAGGACGG - Intergenic
1167272839 19:48516041-48516063 TTATAAAAATAATAACTATTTGG - Intergenic
1167872144 19:52379559-52379581 CTCTAAAAAAATTAAAAATGAGG - Intronic
1167887382 19:52513018-52513040 CTCAAAAAATAATAATAAACAGG - Intergenic
1167957528 19:53078407-53078429 CTCTAAAAAAAATAAATAAAAGG + Intronic
1168244376 19:55103837-55103859 TATTAAAAATAATAAAAATACGG - Intronic
925839062 2:7973904-7973926 CTCGAAAAATCAAATCAATACGG + Intergenic
926454602 2:13050277-13050299 CTCAAAAAATATTAACTATAAGG + Intergenic
926523269 2:13944165-13944187 CTCAAAAAATAAAACAAATATGG - Intergenic
926597952 2:14811407-14811429 CTCTAGAAAAAAAAAGAATAAGG + Intergenic
927220404 2:20702829-20702851 CTCAAAAAATAATAATAATCTGG - Intronic
927834735 2:26385437-26385459 CTCTAAATATATTACCAGTATGG + Intronic
928437288 2:31262912-31262934 CTCAAAAAATAAAAAAATTAGGG + Intronic
928860120 2:35847153-35847175 CTCTAAAAATGATATGAGTATGG + Intergenic
928955971 2:36867937-36867959 CTTTAAAAATACAAACATTATGG + Intronic
929017954 2:37519249-37519271 CTCTGATAATAAAAGCAATATGG - Intergenic
929205874 2:39292300-39292322 CTCTAAATATAATCACATTGTGG - Intronic
929292326 2:40207802-40207824 CTCTAGAAATACTAAAAAAAGGG - Intronic
929965586 2:46532965-46532987 CTATAACAATAATAACAAAAGGG - Intronic
930046038 2:47174251-47174273 CTCAAAAAATAAAAAAAATTAGG - Intronic
930145700 2:48001873-48001895 CTCTGAAAATAAAAACAAAATGG + Intergenic
930404270 2:50934808-50934830 ACCTTAAAATAATAACAATTAGG + Intronic
930521662 2:52474911-52474933 TTTTAAAAATAATAATAATCAGG + Intergenic
930524397 2:52508927-52508949 CTCTGAAAAGAATAACCAAAAGG + Intergenic
930882072 2:56282079-56282101 AACTAATAATAATAACAAAATGG - Intronic
930973637 2:57427574-57427596 TTCTCAAAATAATGACAATCTGG + Intergenic
931351849 2:61497666-61497688 ATCTAAGAGTAATAAGAATATGG + Intronic
931363024 2:61594758-61594780 CTCTAAAAAGAAAAAAAAAATGG - Intergenic
931728569 2:65133139-65133161 CTCAAAAAAAAAAAAGAATAGGG + Intergenic
931890807 2:66670015-66670037 CTCTAAAAACTATAAATATAAGG - Intergenic
932111235 2:69002961-69002983 CTCTAAAGATACTAACATCAGGG - Intergenic
932147133 2:69331865-69331887 CTCTAAAATTAAAAAAAAGAAGG + Intronic
932482378 2:72052903-72052925 CTATAAAAATAAAAAGAGTATGG - Intergenic
932670704 2:73735330-73735352 CTCAAAAAAAAAAAAGAATAGGG + Intronic
932851926 2:75196086-75196108 CTTTAAAAATAACAGCAATGTGG - Intronic
933097169 2:78200267-78200289 CTTTAAATATAAAAAAAATAAGG + Intergenic
933468629 2:82690831-82690853 TTCTAAAAATAATCACAGGAAGG - Intergenic
933736666 2:85500854-85500876 CTATAAGAATAAAAACAATGTGG - Intergenic
933860736 2:86464642-86464664 CTCTAAGAATAATAGAAATGAGG + Intronic
934956360 2:98623700-98623722 AACTAAAAATTATAACAACATGG + Exonic
935073168 2:99713698-99713720 CTCTAGAAAAAAAAAAAATAGGG - Intronic
935509877 2:103958581-103958603 CTATAAAAATATTAATACTATGG - Intergenic
937020396 2:118645716-118645738 CTCAAAAACAAATAAAAATATGG - Intergenic
937605539 2:123797003-123797025 CTCTGAAAAAATCAACAATATGG - Intergenic
937948884 2:127368317-127368339 GTCTCAAAAAAATAAAAATAAGG + Intronic
938030048 2:127984561-127984583 CTCTAAAGATACTGACACTAGGG - Intronic
938054794 2:128206934-128206956 CTCTAAAAATAATAAAAACATGG - Intergenic
938200053 2:129365478-129365500 CTCTAAAAATAATATTTATTAGG + Intergenic
938684390 2:133722949-133722971 CTATAAAAAGAATAACCAAAAGG + Intergenic
939521455 2:143236202-143236224 CTCTTAAAGTACTCACAATATGG + Intronic
939726900 2:145732015-145732037 CTGTAATAATAATAATAAGAAGG + Intergenic
940074738 2:149728602-149728624 CTCTAATAATAATAAAAAAAAGG + Intergenic
940142423 2:150507309-150507331 CTCTAAATATGATCACATTAGGG + Intronic
940398181 2:153217861-153217883 CTTTAAAAATAAAAATAATGAGG - Intergenic
940479183 2:154206300-154206322 CTACAAAAATAATAAAAATTAGG - Intronic
941317986 2:164018555-164018577 TTCAAAAAATAAAAACAAAATGG + Intergenic
941563670 2:167080974-167080996 ATTTAAAAATAATAATTATATGG - Intronic
941621066 2:167779806-167779828 CTCTGAAATTAATAACAGTTGGG - Intergenic
941808382 2:169732834-169732856 CTCAAAAAAGAAAAAAAATAGGG + Intronic
941818575 2:169823275-169823297 TTTAAAAAATAATAACAATCTGG - Intronic
942554258 2:177155376-177155398 CTCTACTAAAAATAAAAATACGG + Intergenic
942840579 2:180355887-180355909 CTTTTAAAATAATTCCAATAGGG + Intergenic
942893400 2:181019263-181019285 CTCTAAAATTTATGAGAATACGG + Intronic
942920454 2:181366937-181366959 CGCTAAAACTAATATCAATAGGG - Intergenic
943480193 2:188407749-188407771 CTAGAAAAATATTAACAAAATGG + Intronic
943688684 2:190846332-190846354 CCCTAAAAACACTAACCATAAGG + Intergenic
944103604 2:196055343-196055365 CTCAAAAAAAAATTACAAAATGG + Intronic
944228825 2:197373284-197373306 CTCTAAACAGATTAAAAATATGG - Intergenic
944700361 2:202240490-202240512 CTCAAAAAAAAAAAACAATCAGG + Intergenic
944720973 2:202422986-202423008 CTTTTAAAATAATAAAGATAGGG + Intronic
944745367 2:202650421-202650443 CTTTAAAAGTAATAAAAATATGG + Intronic
944856424 2:203772041-203772063 CTTTAAAAAGAATTAAAATAAGG + Intergenic
945091630 2:206181358-206181380 TTCTAAAAAAAAAAATAATAGGG - Intronic
945102777 2:206277086-206277108 TTTGAAAAATAATAATAATAAGG - Intronic
945400648 2:209378371-209378393 ATCTAAAAATAATAAAACAATGG - Intergenic
945417438 2:209591439-209591461 GTCTAAAAAAAATAAAAATGAGG + Intronic
945528236 2:210916128-210916150 CTCCTCAAATAATAAGAATATGG + Intergenic
945748007 2:213742904-213742926 GTCTCAAAAAAACAACAATACGG - Intronic
945789577 2:214288246-214288268 CCATAAAAATAATAAAATTAGGG - Intronic
945805044 2:214479787-214479809 GTCTCAAAATAATAATAATCTGG + Intronic
946272046 2:218602543-218602565 CTCTACAAAAAATAAAAATATGG - Intergenic
947397293 2:229698722-229698744 ATAAAAAAATAATAATAATATGG + Intronic
947480810 2:230498157-230498179 CTGTAAGAATAATAATAATGAGG - Intronic
947671607 2:231940240-231940262 GTCTCAAAATAAAAAAAATATGG + Intergenic
948291405 2:236827613-236827635 TTCTAAAAATAATAATAATTTGG - Intergenic
948677165 2:239603390-239603412 ATCTAATAATAAAAACAATTGGG - Intergenic
1168784935 20:530467-530489 CTCTAAAAAAAAAAAAAAAAAGG - Intronic
1168868483 20:1108948-1108970 CTTTAAAAATGAGAAAAATAAGG - Intergenic
1169571838 20:6914706-6914728 CTCTAAAAATAAAAAACATCAGG + Intergenic
1169635811 20:7690243-7690265 GTTAAAAAATAACAACAATAAGG + Intergenic
1169685184 20:8262978-8263000 CTCTAAATATAATCACATTGGGG + Intronic
1169878395 20:10322241-10322263 TCCTAAAAATAATGACAAAAGGG + Intergenic
1170655203 20:18280243-18280265 TTCTAAAAATACTAAATATATGG + Intergenic
1170675880 20:18480586-18480608 CTCAAAAAAAAAAAACAATGTGG - Intronic
1170844456 20:19950529-19950551 CCCTAAAAAGAAAAAAAATAGGG - Intronic
1171052705 20:21874830-21874852 GTGTAAAACTAATAAAAATATGG + Intergenic
1171079945 20:22169916-22169938 CTCTACAAATAATACAAAAATGG - Intergenic
1171096664 20:22338569-22338591 TTCTTATAATAATAATAATAGGG + Intergenic
1171128433 20:22625507-22625529 CTCTGATAATAATAATAATAAGG - Intergenic
1171383320 20:24750121-24750143 CACTAAAAAAAAAAATAATAAGG + Intergenic
1171782607 20:29434030-29434052 TTCTACAAATTATTACAATATGG + Intergenic
1172001395 20:31780918-31780940 CTCTAAAAAGCAAAACAAGAAGG - Intronic
1172367577 20:34361765-34361787 CTACAAAAATAAAAACAATTAGG + Intergenic
1172500630 20:35424078-35424100 CTCAAAAAAAAGTAAAAATATGG + Intergenic
1172543385 20:35740088-35740110 AATTAAAAATAAAAACAATATGG + Intronic
1172622225 20:36326641-36326663 CACTGAAAATAATAACTACATGG - Intronic
1172761069 20:37322549-37322571 CTCTAGTAATCAAAACAATATGG - Intergenic
1172996905 20:39077565-39077587 CACAAAAAATAATAATAATAAGG - Intergenic
1173585585 20:44180591-44180613 TAATAAAAATAATAACAGTAAGG - Intronic
1173792914 20:45839904-45839926 CTCAAAAAATAATAATTAAAAGG + Intronic
1173985906 20:47261221-47261243 CAAAAAAAATAATAATAATAAGG + Intronic
1174253339 20:49235742-49235764 CTCAAAAAAAAAAAAAAATAGGG - Intronic
1174520895 20:51129729-51129751 ATCTAAAAATTATAATAAAATGG - Intergenic
1174595942 20:51683580-51683602 CTCTACAAAAAATAAAAACATGG - Intronic
1175473105 20:59247539-59247561 CTCTAAAAGTAATAACTTTGTGG - Intronic
1176189634 20:63802415-63802437 CTCTCAAAAAAAAAACAATGAGG + Intronic
1176341559 21:5702202-5702224 CTACAAAAATAAAAACAATGTGG + Intergenic
1176473813 21:7134354-7134376 CTACAAAAATAAAAACAATGTGG + Intergenic
1176503268 21:7622254-7622276 CTACAAAAATAAAAACAATGTGG - Intergenic
1176535880 21:8100271-8100293 CTACAAAAATAAAAACAATGTGG + Intergenic
1176773169 21:13102285-13102307 ATCTAAAAAAAAAAAAAATATGG - Intergenic
1176864629 21:14038998-14039020 CTCTAAGACAAATAAAAATATGG - Intergenic
1176930078 21:14799288-14799310 TCCTCAAAATAATAAAAATAGGG - Intergenic
1177366503 21:20146135-20146157 CTGTAAAAATAACAACATCAAGG - Intergenic
1177717283 21:24855043-24855065 CATTAAAAATAGTAATAATAGGG + Intergenic
1177822095 21:26042462-26042484 CTCAGAAAATAATAACCAGATGG - Intronic
1178224332 21:30698484-30698506 CATTAAAAATCAAAACAATAAGG + Intergenic
1178596078 21:33953686-33953708 CTCACAAAGTAATAACTATAAGG - Intergenic
1178869691 21:36362541-36362563 CTCAAAAAATAAATAAAATAGGG + Intronic
1180309979 22:11160855-11160877 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1180548458 22:16522665-16522687 GTCTCAAAAAAATAAAAATAAGG - Intergenic
1181452695 22:23034495-23034517 ATCTAAAAAAAAAAAAAATAGGG + Intergenic
1181585768 22:23852824-23852846 CTCAAAAAATAAAAATAAAAAGG - Intergenic
1181810190 22:25399376-25399398 CTCCAAAAAATATTACAATAAGG + Intronic
1182036598 22:27203332-27203354 CAATAATAATAATAATAATAGGG + Intergenic
1182139508 22:27941147-27941169 CTCTAAAAATTACAAAAAGAAGG - Intergenic
1182210997 22:28677634-28677656 GTCTCAAAAAAATAAAAATAAGG + Intronic
1182286474 22:29251380-29251402 CTCTAAAAAAAAAAAAAAAATGG - Intronic
1182449397 22:30409895-30409917 ATCTCAAAAAAATAAAAATAGGG + Intronic
1182856551 22:33522530-33522552 CTCTAAAAAAAATACAAAAAAGG + Intronic
1182977745 22:34639213-34639235 TTGCAAAAATAATAACAAGACGG - Intergenic
1183877332 22:40794917-40794939 CTCTAAAAATATTAAAAAATAGG - Intronic
1184009412 22:41735531-41735553 CTATAAAAAAAATAACAATATGG - Intronic
1184367137 22:44058945-44058967 CTATGAAAGTAATAACAAGAAGG - Intronic
1185189860 22:49428327-49428349 CTCAAGAAAAAATAACAAAAAGG - Intronic
1203240827 22_KI270733v1_random:16666-16688 CTACAAAAATAAAAACAATATGG + Intergenic
949150931 3:766111-766133 CTCTTAAAATAACATCAATCAGG - Intergenic
949403645 3:3692415-3692437 TTCTGAAAATATTAACAAAATGG + Intergenic
949746483 3:7299433-7299455 TTCTAAAAATTCTAAAAATAAGG - Intronic
949980142 3:9497618-9497640 CTCAAAAAAAAAAAAAAATAGGG - Intergenic
950508398 3:13410615-13410637 TTCTAAAAAAAAAAACAAAAAGG + Intronic
950636067 3:14315790-14315812 CAAAAAAAATAATAATAATAAGG - Intergenic
950897045 3:16462294-16462316 CTATAAGAATAATAATAGTACGG - Intronic
951375336 3:21907955-21907977 CTATAGAAATAAAAACAACAGGG + Intronic
951692266 3:25408733-25408755 TTAAAAAAATAATAACAACAGGG + Intronic
952036166 3:29204403-29204425 CTCTGAAAATAATGACTAGATGG - Intergenic
952537374 3:34325249-34325271 CTATAAAAATAGTAATAACAAGG + Intergenic
952972185 3:38658515-38658537 TTCTAAAAATAAAAACATCAGGG + Intergenic
953107001 3:39892158-39892180 CTCTAGGAGTAATGACAATAGGG + Intronic
953114968 3:39983748-39983770 CTCTAAGAAAAATAATAGTAGGG + Intronic
953184216 3:40623399-40623421 CTTTAAAAATACTCACAATGTGG + Intergenic
953365922 3:42344889-42344911 CTCAAAAAAAAAAAAAAATAAGG + Intergenic
953469388 3:43154188-43154210 CTCTAAAATAAATACCATTAAGG - Intergenic
953703230 3:45212538-45212560 TTTTTAAAATAATAAGAATAAGG - Intergenic
953739124 3:45521434-45521456 CTCTAAAAATAAAATTAAAAGGG + Intronic
953766200 3:45745948-45745970 AACTAAAAATAAAAACTATAAGG - Intergenic
953779789 3:45857522-45857544 ATTTAAAAATAAAAACAAAAGGG + Intronic
953810732 3:46110373-46110395 CTTTAAAAACAATAATAATGTGG + Intergenic
953892572 3:46764492-46764514 CTTTAAAAATAAAAAATATAGGG + Intronic
953941765 3:47105407-47105429 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
954015082 3:47681800-47681822 CTCTTAAAAGAATAACCGTAAGG + Intronic
954178307 3:48861724-48861746 CTCAAAAAATAATAATAATAAGG + Intronic
955083702 3:55681248-55681270 CTCTAAAAATTACAACAAATTGG - Intronic
955092093 3:55762526-55762548 TTTTAAAAAAAATAAAAATAAGG - Intronic
955152984 3:56387257-56387279 CTATAACAATAATAACAAATTGG - Intronic
955293615 3:57715349-57715371 ATCTAAAAAAAATATTAATAGGG + Intergenic
955957597 3:64306349-64306371 CTCTAAATACAATTACATTAGGG - Intronic
956049091 3:65228348-65228370 TTTAAAAAATAATAATAATATGG + Intergenic
956116170 3:65921026-65921048 CTCAAAAAAAAAAAACAAAATGG + Intronic
956120683 3:65963028-65963050 CTGTTAAAATAATGACAATCTGG + Intronic
956335768 3:68161721-68161743 AACTCAAAATAATAACAAAATGG - Intronic
956438647 3:69259030-69259052 ATGTAAAAATAATAGAAATAAGG - Intronic
956439029 3:69261967-69261989 GTCTTAAAAAAATAAAAATAGGG - Intronic
956714927 3:72070678-72070700 CAATAATAATAATAATAATAAGG - Intergenic
956826621 3:73003210-73003232 CTCAAAAAAAAAAAACAAAAGGG - Intronic
956933164 3:74069455-74069477 CTGTAAAAATTATAAGACTAGGG + Intergenic
957082871 3:75652293-75652315 TTCTACAAATTATTACAATATGG - Intergenic
957330843 3:78760805-78760827 CTCTACAAAAAATAAAAATTTGG - Intronic
957826258 3:85448748-85448770 TTTTAAAAATAATAAAAATTCGG + Intronic
957838576 3:85634618-85634640 TCCTAAAAATAATTACAATATGG + Intronic
958440588 3:94151476-94151498 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
958454451 3:94312154-94312176 CTCTAAGAATAAGAATAAAAAGG - Intergenic
959160701 3:102721130-102721152 CTTAAAAAATAATAATAATAGGG - Intergenic
960045818 3:113196896-113196918 TGTTAAAGATAATAACAATAGGG - Intergenic
960105821 3:113795855-113795877 CTCTAAATTTAAAAAAAATATGG - Exonic
960138864 3:114132988-114133010 CTCAAAAAAAAAAAAGAATACGG - Intronic
960225271 3:115160724-115160746 TTCTTAAAACAATAACAACAAGG + Intergenic
960505019 3:118482067-118482089 CTTTCAAAATAATAAGAATAAGG - Intergenic
960948094 3:122980629-122980651 CAATAAAAATAATAATAATTTGG - Intronic
961070046 3:123915423-123915445 CCCTCAAAATAGTAACACTAGGG - Exonic
961263147 3:125618668-125618690 ATCTACAAATAAATACAATAAGG - Intergenic
961933852 3:130562486-130562508 ATCTATAAATCATAAAAATATGG - Intronic
962166670 3:133056435-133056457 TTCTAAAAATAAAAACATTGAGG - Intronic
962195966 3:133363700-133363722 CTATAAAAATAATAACAGGCCGG - Intronic
962302086 3:134251665-134251687 TTATAAAAAAAATAACAATTTGG - Intergenic
962778005 3:138681865-138681887 AACTAAAAATAAGAACAAGAGGG + Intronic
963017343 3:140838589-140838611 CACTAAAAATAACAATAGTATGG + Intergenic
963182669 3:142375713-142375735 CTCTAAAACTAATATCAGGAAGG + Intronic
963182720 3:142376595-142376617 CTTTAAATATAAAAACAAAAAGG + Intronic
963524186 3:146395494-146395516 CACTGAAAATAGTAAAAATATGG - Intronic
963946201 3:151148142-151148164 CTCCAAAAATAATAAACAAATGG - Intronic
963961682 3:151316201-151316223 CTCTTTAAAAAAAAACAATACGG + Intronic
963988693 3:151627985-151628007 CTCACATAATAATAAAAATAAGG - Intergenic
964416901 3:156457321-156457343 CACTAAAACTAAGAAAAATAAGG + Intronic
964717095 3:159734108-159734130 CAATAATAATAATAACAATATGG - Intronic
965046258 3:163582069-163582091 CTCTTAAAATGAAAGCAATAGGG + Intergenic
965130218 3:164689345-164689367 CTGTAAAGATGAAAACAATAAGG - Intergenic
965331111 3:167375808-167375830 CTCTAAATATAATTGCAAAATGG + Intronic
965463279 3:168995997-168996019 CTATAGAATTAATAGCAATAGGG + Intergenic
965523742 3:169695460-169695482 CCTTAAAAAGAATAACAATGGGG + Intergenic
965863733 3:173179244-173179266 AACTAAAAATAATAAAAATAGGG - Intergenic
965873889 3:173293812-173293834 CCATAAAAAAACTAACAATAGGG - Intergenic
966070147 3:175866428-175866450 CTGTAAAAAAAATAAACATAGGG - Intergenic
966102028 3:176281739-176281761 TTCTAAAAATAATATTGATATGG - Intergenic
966586583 3:181633213-181633235 CTTAAAAAATTAGAACAATATGG - Intergenic
966598623 3:181751584-181751606 ATAAAAAAATAATAATAATAAGG - Intergenic
966615324 3:181907164-181907186 CTCAAAAAAAAACAACAAGATGG - Intergenic
966681755 3:182649078-182649100 TTCTAAAAATAATTACAGTAAGG - Intergenic
966699614 3:182833330-182833352 CTCTAAAAAAGATAAAATTAAGG - Intronic
966705625 3:182910572-182910594 CTCTAAAAATAATAAAAATAAGG + Intronic
966830169 3:184001250-184001272 CTCTAAAAATAAAAAGTAAAAGG + Intronic
967006461 3:185387744-185387766 CTCTAAGAACTAGAACAATATGG + Intronic
967202358 3:187083337-187083359 CTCTACAAAAAATAAAAAAAGGG + Intergenic
967400842 3:189058849-189058871 CTCAAAATATATTAACTATAAGG + Intronic
967439992 3:189495996-189496018 CTCAAATAATAATATCAGTAAGG - Intergenic
967534037 3:190581979-190582001 TTCTAAAAAAAATAAAAATGAGG + Intronic
967584370 3:191194059-191194081 CATTAATAATAATAACAATAGGG - Intergenic
967790244 3:193540947-193540969 CTTTTAAAATCAGAACAATAGGG + Intronic
967810007 3:193751056-193751078 CTCCAAAAATACTAACTACATGG - Intergenic
968096468 3:195934108-195934130 GTCAAAAAAGAATAAGAATAAGG + Intergenic
968188525 3:196650442-196650464 CTCTAAAAAAAATACAAAAATGG - Intronic
968239513 3:197064191-197064213 CTCAAAAAAAAAAAAAAATAAGG - Intronic
968851932 4:3086918-3086940 TTCTAAAAATAAAAAAAAGAAGG - Exonic
968858122 4:3144316-3144338 CTCAAAAAATAAAAATAAAAAGG - Intronic
969996868 4:11322136-11322158 CTTTAAAAATGAAAACAATGTGG + Intergenic
970290164 4:14563339-14563361 CTCTAATAATAAAAGCAACATGG + Intergenic
970292467 4:14589102-14589124 CTGTAATAATAAATACAATATGG - Intergenic
970389334 4:15591834-15591856 CTCTCAAAACAATTACTATATGG + Intronic
970447837 4:16139179-16139201 CTCTAAAAATAATAAAAAGGAGG - Intergenic
970749821 4:19344995-19345017 CTCAAAAAAAAAAAAAAATATGG + Intergenic
970811776 4:20102698-20102720 CTAAAATAATAATTACAATATGG - Intergenic
971447730 4:26769362-26769384 CACTAGAAATAATAACCATGTGG + Intergenic
971544234 4:27864721-27864743 CTGTAAAAATATTAAAAATGAGG - Intergenic
971821333 4:31559278-31559300 CTCTATAATTACAAACAATAGGG - Intergenic
971822899 4:31581815-31581837 ATCTTAAAATAATATCAATATGG - Intergenic
971886619 4:32457450-32457472 ATATAAAAATAATATAAATAGGG - Intergenic
971974138 4:33661184-33661206 ATATAAAAATAATAACAATTGGG + Intergenic
972103938 4:35459293-35459315 CAAGAAAAATAATAACAAAATGG - Intergenic
972128076 4:35794636-35794658 CTCAAAAACAAATAACAAAATGG + Intergenic
972208601 4:36809338-36809360 CTCTATAATTAAAAACAGTATGG - Intergenic
972208609 4:36809539-36809561 ATTTAACAATAATAATAATAAGG - Intergenic
972367313 4:38388343-38388365 CAGGAAAAATAATAACAATGGGG + Intergenic
972709500 4:41580352-41580374 GTATAGAAATAATAACAAGAAGG + Intronic
972805370 4:42524669-42524691 CTCTAAGTCTAATAATAATAAGG + Intronic
972846037 4:42990558-42990580 CTCTAACTATAATAAAAATTAGG - Intronic
972993288 4:44848970-44848992 CTCTAAAAACTATAAATATAGGG + Intergenic
973084479 4:46038682-46038704 TTCTAAAAATAAGAATAAAAAGG - Exonic
973125593 4:46580288-46580310 CTATAAAAATCATAGAAATATGG - Intergenic
973136783 4:46718398-46718420 CTCTTACAATTATAATAATAGGG - Intergenic
973548676 4:52008547-52008569 CTATAAAAAGAATAAAGATATGG + Intronic
973598733 4:52519963-52519985 CTTTAAAAAGAAAAAAAATATGG + Intergenic
973672579 4:53236734-53236756 CTTTAAAAATAATAATTACAGGG + Intronic
973683778 4:53348713-53348735 CTCAAAAAAAAAAAAAAATATGG - Intronic
973803929 4:54506516-54506538 CTCCAAAAGTAATATTAATATGG - Intergenic
973828735 4:54736858-54736880 CTCTAAAAAGAAAAATAAAAGGG - Intronic
974040309 4:56851671-56851693 CTCAAAAAACAACAACAACACGG + Intergenic
974291341 4:59935065-59935087 GTATAAAAATGAGAACAATATGG - Intergenic
974898116 4:67964301-67964323 CTCCAAAAATAAAAAGAATAAGG - Intergenic
975009619 4:69333346-69333368 TTCCAAAAATAATAAAAATCAGG - Intronic
975087504 4:70360287-70360309 CTCTCAAGTTAATAACAACAGGG + Intergenic
975155897 4:71072765-71072787 CTCAAAAAATAAAAATAAAAAGG - Intergenic
976246250 4:83008912-83008934 TTTTAAAAATAATTAAAATAGGG - Intronic
976525307 4:86080872-86080894 CTCCAAAATAAATACCAATAGGG + Intronic
976660198 4:87532800-87532822 CTCTAAATATAGTGACAATGGGG + Intergenic
976723282 4:88191269-88191291 CTCAAAAAAAAAAAACAAAAAGG + Intronic
977039267 4:91994698-91994720 CTCAAAAAACAAAAACAAAAAGG + Intergenic
977194150 4:94038537-94038559 AACTAAAAATAATAAAAATATGG - Intergenic
977695906 4:99965511-99965533 CTTTAAAAATAATAAAACAAAGG - Intergenic
977717893 4:100204053-100204075 CTCTAAAAATAAGGACAGTTTGG + Intergenic
978013314 4:103713615-103713637 GTATAATAATAATAATAATAAGG + Intronic
978309717 4:107373103-107373125 CTATAGTAATAAAAACAATATGG + Intergenic
978568955 4:110115591-110115613 TTCCAGAAATAATAATAATATGG + Intronic
978583265 4:110253229-110253251 CTCAAAGAATAATAATAATTAGG - Intergenic
978612654 4:110560873-110560895 CTATAAAAATAAGAATAATTTGG - Intronic
978916811 4:114135918-114135940 CTCAAAAGAAAATATCAATAAGG + Intergenic
978918727 4:114155627-114155649 TTTTAAAAATTATAATAATAAGG - Intergenic
979092241 4:116499469-116499491 CTCTTAAAAAAATAAAACTAAGG + Intergenic
979124243 4:116947345-116947367 TTCTTAAAACAATAATAATAAGG - Intergenic
979255001 4:118599898-118599920 CTCAAAAAAAAAAAAGAATATGG + Intergenic
979525368 4:121710352-121710374 CAGTAAAAATAATTACAGTAAGG + Intergenic
979538978 4:121857628-121857650 TTTTAAAAATAATAAGCATATGG + Intronic
979696745 4:123621392-123621414 CTCTAAAAATAAGAAAGAAAAGG - Intergenic
979762081 4:124419014-124419036 TTCTAAAAATAAAAAAAATGTGG + Intergenic
979877277 4:125909132-125909154 CTACAAAAATAAATACAATAGGG + Intergenic
980033282 4:127855029-127855051 CACCAAAAATAATACTAATAGGG + Intergenic
980187503 4:129480544-129480566 CTCAAAAAATATTAAGACTATGG - Intergenic
980205362 4:129712565-129712587 CCTGAAAAATAATAAAAATATGG - Intergenic
980241745 4:130187023-130187045 CTCTTAAAATAATTATAATTAGG + Intergenic
980306690 4:131070489-131070511 GTCTTAAAATAATAAAAATTTGG + Intergenic
980543547 4:134227525-134227547 CTTTAAAAATAAAAATAATATGG + Intergenic
980636832 4:135516693-135516715 CTCATAAAATAAGAACCATATGG - Intergenic
980670744 4:136003133-136003155 CTATAAAAATAATAACATAGAGG + Intergenic
981037629 4:140188812-140188834 CAGGAATAATAATAACAATAAGG + Intergenic
981057447 4:140378883-140378905 CTTTAAAAATAATAACTGTACGG + Intronic
981266696 4:142792639-142792661 CTCTAAAATTAATGAGAATATGG - Intronic
981623521 4:146731199-146731221 CTCAAAAGATAATGACCATAAGG - Intronic
981731104 4:147899479-147899501 CTCTACCAATAAGAACAAGACGG - Intronic
982009915 4:151096767-151096789 CTAAAAAAATAATAATAAAATGG - Intergenic
982014604 4:151141069-151141091 CTCTAAATAAATGAACAATATGG + Intronic
982044633 4:151431395-151431417 TTTTAAAAACAATAATAATAAGG - Intronic
982411888 4:155086863-155086885 GTATGAAATTAATAACAATAAGG + Intergenic
982418191 4:155161879-155161901 GTCTAACGATAAAAACAATAAGG + Intergenic
982570669 4:157047142-157047164 CTCCAAAAATACTAGGAATAGGG + Intergenic
982577496 4:157133534-157133556 CTTTTAAAAAAATAACTATAAGG - Intronic
982586886 4:157253115-157253137 CTCAAAAAAAAAAAACAAAAAGG - Intronic
982801996 4:159717272-159717294 GTCTAAAAATAAAAAAATTAAGG + Intergenic
983002662 4:162437286-162437308 CTTTGAAATTAATAAAAATAGGG - Intergenic
983395040 4:167183043-167183065 CTCAAGAAATAAGAACAATCAGG - Intronic
983473570 4:168187042-168187064 CAATAATAATAATAACATTAGGG + Intronic
983567740 4:169172551-169172573 ATCTCCAAATAAAAACAATAAGG - Intronic
983612102 4:169658269-169658291 CTTTAAAAATAATTCAAATATGG + Intronic
983730607 4:170989064-170989086 CTTTGAAATTAATAAAAATAGGG - Intergenic
983822240 4:172210172-172210194 ATCTAAAACTGATAAAAATAAGG - Intronic
983982797 4:174019435-174019457 TTATAATAATAATAATAATATGG - Intergenic
984196859 4:176667301-176667323 GTCTCAAAATAACAATAATAAGG + Intergenic
984374221 4:178906677-178906699 TGCCAAAAATAATAAAAATAAGG + Intergenic
984446989 4:179849443-179849465 CTCTGAATATGAGAACAATATGG + Intergenic
984789045 4:183597147-183597169 CTTTAAAAATACTAACATTTGGG + Intergenic
985017674 4:185653654-185653676 CTCAATAAATAATAACACTAGGG + Intronic
985042016 4:185900125-185900147 CTCTAAAAATAAAAAGAAGAAGG + Intronic
985209170 4:187573351-187573373 CTATAAAAATAAAATCAGTAAGG - Intergenic
985448672 4:190044538-190044560 CTCTACAAATTATTACAATATGG + Intergenic
986008539 5:3689321-3689343 CTTTAGAAACAATAATAATAGGG - Intergenic
986100981 5:4611196-4611218 TTCTAAGTCTAATAACAATATGG - Intergenic
986465391 5:8016177-8016199 TTCTACAAATATTAATAATAAGG - Intergenic
986951764 5:13096393-13096415 CTCTAAAAATAAAATAATTAGGG + Intergenic
987658291 5:20837976-20837998 TACTAAAAATAATAAAAATTAGG + Intergenic
987829772 5:23080749-23080771 CTCTAACAAAAAGAACAAAAAGG - Intergenic
988142445 5:27261367-27261389 ATCTAAAAACAACAACAACAAGG + Intergenic
988249158 5:28732276-28732298 CTTTTAAAATATTAACATTAGGG - Intergenic
988385094 5:30552793-30552815 CTTTAAAAAATATAACATTAGGG - Intergenic
988432720 5:31138249-31138271 CTCAAAAAAAAAAAAAAATAGGG + Intergenic
988460681 5:31434282-31434304 ATCCAAAACTAAAAACAATAAGG + Intronic
988462775 5:31455940-31455962 CTGTCAAAAGTATAACAATATGG - Intronic
988765392 5:34367966-34367988 TACTAAAAATAATAAAAATTAGG - Intergenic
989076327 5:37567006-37567028 CTCCAAAATTAATAATAGTATGG + Intronic
989191560 5:38674688-38674710 AGCTATAAATAATAACAATTTGG - Intergenic
989304430 5:39936121-39936143 ATCTAAACATAGTAAAAATATGG - Intergenic
989304616 5:39938936-39938958 CTAGAGAAATAATAACAATATGG + Intergenic
989476471 5:41880035-41880057 CAACAAAAATAATAGCAATATGG + Intergenic
989769985 5:45132899-45132921 TTCTAAAGAAAATAACAAAAGGG - Intergenic
989791275 5:45404648-45404670 CCCTAAATTTAGTAACAATATGG - Intronic
990048892 5:51470215-51470237 CTATAAAAATAATGAGAAAATGG + Intergenic
990149792 5:52803413-52803435 CTGAAAATATAATAACAATCAGG - Exonic
990384587 5:55247431-55247453 CTCTAAAAATAATTACTTCAAGG + Intergenic
990509616 5:56478645-56478667 CCTTAATAATAATAATAATAAGG + Intronic
990537120 5:56733694-56733716 CTCTGAAGAGAAAAACAATAGGG + Intergenic
990798221 5:59568490-59568512 GTATGAAAATAATAAAAATAAGG + Intronic
990804864 5:59648718-59648740 CTCAAAAAAAAAAAAAAATAAGG + Intronic
991420851 5:66440045-66440067 CTGTAAAAAAACTCACAATAAGG + Intergenic
991558442 5:67922755-67922777 CTGTAATAATAATAATAACAAGG - Intergenic
991641960 5:68763429-68763451 CTCTAAACATAATTTCAATGTGG - Intergenic
991906634 5:71520305-71520327 ATCTTAAAATAAAAGCAATATGG - Intronic
992051380 5:72944006-72944028 CTCAAAAAATAATTATAATAAGG - Intergenic
992596127 5:78348952-78348974 CTCTAAAAACAACAAAAACATGG + Intergenic
993136198 5:83967465-83967487 CTCTAAGAATGAAAACAAGAGGG + Intronic
993941129 5:94060349-94060371 CTCAAAAAAAAAGAACAAGAAGG + Intronic
994153766 5:96479449-96479471 CTCAAAAAAAAAAAAAAATAAGG - Intergenic
994205225 5:97027350-97027372 CTCAAAAAAAAAAAACAAAAAGG + Intronic
994694183 5:103053618-103053640 TAATAATAATAATAACAATAGGG - Intergenic
994797533 5:104323343-104323365 CTCAAAAGTTTATAACAATAAGG + Intergenic
994892818 5:105660269-105660291 GTTTAAAAATATTCACAATATGG - Intergenic
994939307 5:106300825-106300847 CTTTAAAAATATTATGAATAAGG + Intergenic
994945825 5:106389833-106389855 CTGTTAAAATTATAAAAATATGG - Intergenic
994982014 5:106887699-106887721 ATCTAAAAATAAGAGCAATTTGG + Intergenic
995015918 5:107308455-107308477 CCTTAGAAATAATAACAACAAGG - Intergenic
995153919 5:108886765-108886787 CTCTAACAATAATAACTCCATGG - Intronic
995270287 5:110212679-110212701 CAATAAAGATAACAACAATAAGG - Intergenic
995757781 5:115528123-115528145 CTTTAAAAAAACAAACAATAAGG + Intronic
995789676 5:115872011-115872033 CTTTAAAAATAAAAACATTGTGG + Intronic
996132477 5:119798251-119798273 CTTAAAAAATAACAAAAATATGG + Intergenic
996328954 5:122309144-122309166 CTTTAAAAATAGAAAAAATAAGG + Intergenic
996412102 5:123169757-123169779 TTCTAAAAATAATAGCAGCATGG - Intronic
996446417 5:123557817-123557839 CTCCAAAAAGACTAAGAATATGG - Intronic
996924691 5:128810783-128810805 CTCTAGAACTAATATCTATAGGG - Intronic
997285014 5:132671929-132671951 ATTTAATAATAATAATAATAAGG + Intergenic
997773805 5:136579757-136579779 AACTAAAAATAATAAAAAAATGG + Intergenic
997867619 5:137478827-137478849 TTCTAAAAATAATAATAATAAGG + Intronic
998123774 5:139601611-139601633 CTCAAAAAATAAAAACAGGACGG + Intronic
998241260 5:140447201-140447223 CTCTAAAAATAATAAAAAATAGG - Intronic
998839822 5:146241482-146241504 CTCAAAAAATAATAATAATTTGG - Intronic
999062609 5:148652739-148652761 CTATAATAATAATTATAATAAGG + Intronic
999163969 5:149531882-149531904 CTCAAAAAATAATAATAATAAGG - Intronic
999307691 5:150530858-150530880 CTTTAAAAATAGAAAAAATAGGG - Intronic
999934323 5:156468989-156469011 CTCAAAAAATAATAATAATAAGG + Intronic
1000461070 5:161518677-161518699 CTCTAAAAATACTCACATCATGG + Intronic
1000625013 5:163528769-163528791 ACCTAAAAATAATGACAATAGGG - Intergenic
1000729241 5:164810713-164810735 CACTAAAAATAAGAACAGTTTGG - Intergenic
1000884680 5:166737344-166737366 CTCTGAAAACAATAAAAAGATGG - Intergenic
1001032339 5:168272023-168272045 CTCAAAAAATAATAATAATGTGG + Intergenic
1001622008 5:173095160-173095182 CTATAGTAATTATAACAATATGG - Intronic
1001672110 5:173482115-173482137 CTCTAAAAATATAATCACTAAGG - Intergenic
1001726869 5:173910872-173910894 ATATAAAAAAAATAATAATAAGG - Intronic
1002507957 5:179693371-179693393 CTCTACAAAAAATAAAAATTAGG + Intronic
1002557091 5:180050806-180050828 CTCCAAAAATAAAAATAAAAAGG - Intronic
1002670885 5:180865743-180865765 GTCTTAAAATAAGAACAATAGGG + Intergenic
1002725189 5:181289964-181289986 CTCAAAAAAAAAAAAGAATATGG + Intergenic
1003217091 6:4123959-4123981 CTCTTAAAAAAAAAAAAATAAGG + Intronic
1003431327 6:6041061-6041083 CTTTAAAAAGAAGAAAAATAAGG - Intergenic
1003541691 6:7023988-7024010 CTCTAAAAAAAAGAAAAAAAGGG - Intergenic
1003672853 6:8175647-8175669 CTCTAAAAAAAAAAAAAATCAGG - Intergenic
1004040898 6:11974171-11974193 CTCTAAAAAAAAAAAAGATAGGG + Intergenic
1004142533 6:13032773-13032795 CTCTATAAAAAATAAAAATTAGG - Intronic
1004462176 6:15847905-15847927 GTCTCAAAATAATAATAAAAAGG + Intergenic
1004764951 6:18715550-18715572 CTATAAAAAAAGCAACAATAAGG + Intergenic
1004765036 6:18716264-18716286 CTATAAAAAAAGCAACAATAAGG - Intergenic
1005763921 6:28992054-28992076 GTTTAAAAAAACTAACAATATGG - Intergenic
1006394014 6:33775316-33775338 CTCTTAAAAAAATAAAAAAAAGG - Intronic
1006577076 6:35054328-35054350 CTCTAAAAATAACAGCAAGATGG - Intronic
1007685363 6:43664394-43664416 CACTAAAAAAATTAATAATAAGG - Intronic
1008285266 6:49641693-49641715 TTATAAAAAGAAAAACAATATGG - Intergenic
1008877282 6:56343157-56343179 CTTTAAAAGTAATCACCATAGGG + Intronic
1009311375 6:62157052-62157074 CTCTTAAAAGAATAAGAATGAGG + Intronic
1009603235 6:65831481-65831503 CTCTAAAGATTATAAAAACAGGG + Intergenic
1009961467 6:70527780-70527802 CTCTAAAAATACCAATAAGAAGG - Intronic
1010006948 6:71005993-71006015 CTATAATAATCAAAACAATATGG - Intergenic
1010350299 6:74865718-74865740 CTATAAAAATAATAAAAAATTGG - Intergenic
1010428541 6:75752156-75752178 CTCTAATAATAATAAAAAATTGG - Intronic
1010613042 6:77979457-77979479 CTCAATAAATAACATCAATATGG - Intergenic
1010867223 6:80992477-80992499 CACTAGAAATAATAAAGATATGG + Intergenic
1010986319 6:82428910-82428932 ACATGAAAATAATAACAATAAGG + Intergenic
1011043268 6:83054499-83054521 TTCTAAAAATACCAACATTAAGG + Intronic
1011229591 6:85145460-85145482 CTATAATAATCAAAACAATATGG - Intergenic
1011280944 6:85677052-85677074 ATTTAAAAGTAATAACAAAAAGG + Intergenic
1011605179 6:89096659-89096681 CTATAAAAATAATAATAACTAGG - Exonic
1011672610 6:89697580-89697602 CTCAAAAAAAAAAAAAAATAGGG - Intronic
1011678706 6:89761645-89761667 CTCTACAAATGCGAACAATAAGG + Exonic
1011732427 6:90279220-90279242 CTCTTAAAAAAAAAAGAATACGG + Intronic
1011765337 6:90613395-90613417 CTATAAAAATAAGAATAATCAGG - Intergenic
1011959059 6:93064036-93064058 ATTTAAAAATAGAAACAATATGG - Intergenic
1011959247 6:93067176-93067198 ATCTATAAATAAAAACTATAGGG + Intergenic
1012827723 6:104166179-104166201 CACAAAAAAAAATAACAAAATGG + Intergenic
1013114143 6:107088005-107088027 CTCTAAAAAAAAAAAAAAAAGGG - Intronic
1013187518 6:107773280-107773302 CACTAAAAATATGAATAATAAGG + Intronic
1013223804 6:108104602-108104624 CAAAAAAAATAATAATAATAAGG - Intronic
1013534302 6:111049592-111049614 CTTTAAAAATACCAACAAAATGG - Intergenic
1014551380 6:122792636-122792658 CTCTAAAAAAAAAAAAAAAAGGG - Intronic
1014808878 6:125863037-125863059 AACTAAAAATATTAAAAATATGG + Intronic
1015241799 6:131032727-131032749 CTGCCAAAATAATAACCATAAGG + Intronic
1015372717 6:132473157-132473179 CTCAAAAAATAAAAATAAAAAGG + Intronic
1015478352 6:133678623-133678645 AATTAAAAATAATAATAATAAGG + Intergenic
1015666285 6:135633416-135633438 CTTTAAAAATCACAACAAAATGG - Intergenic
1015759464 6:136643281-136643303 CCCTAAAATAAATAACAAAATGG + Intronic
1015794769 6:137000232-137000254 CTGTACCAATAATATCAATAAGG + Exonic
1016601359 6:145865207-145865229 CTCTAAACGTCATAACATTAGGG - Intronic
1016688741 6:146911334-146911356 CTTTACAAATAATAAAAATAAGG + Intergenic
1016724743 6:147349957-147349979 ATCCAAATATAATAGCAATATGG + Intronic
1017019407 6:150128238-150128260 ATTTAAAAATATTAACTATAAGG + Intergenic
1017354408 6:153486310-153486332 CTCTAAAAACATTATCATTATGG - Intergenic
1017651875 6:156590917-156590939 CGCTAAAAGTAACAACAATGGGG - Intergenic
1018467345 6:164061553-164061575 TTCTAAAAATAATGACAATTTGG + Intergenic
1019388463 7:771968-771990 TTCTAAAAATAAAAACCAAACGG - Intronic
1019671330 7:2281256-2281278 CTCTACAAAAAATAAAATTACGG + Intronic
1019887946 7:3921799-3921821 CTATAAAAATAAAAAAAATCAGG + Intronic
1020192111 7:6008611-6008633 CTATAAAAATAAAAATAAAAGGG + Intronic
1020237056 7:6364398-6364420 CTCTAAAAACAAAAAAAAGAAGG + Intergenic
1020384348 7:7581552-7581574 CTCTAGAAATAAATACAATTTGG - Intronic
1020412272 7:7905919-7905941 CTTTAAAAATAATAGTAGTATGG + Intronic
1020514612 7:9101633-9101655 CACCAACAACAATAACAATAAGG + Intergenic
1020749953 7:12128439-12128461 CTTTAAAAGTAATAGCAAAAGGG - Intergenic
1020805225 7:12781735-12781757 TTCTTAAAATAAGAACAAAATGG + Intergenic
1020893353 7:13907818-13907840 CTCTTAAAATAATTACAGAAAGG + Intronic
1021133230 7:16936076-16936098 TTGAAAAAATAATAATAATAAGG - Intergenic
1022588810 7:31641904-31641926 CTCAAAACCAAATAACAATATGG - Intronic
1022778224 7:33550009-33550031 CTCTAAAAATAAAATCATGAAGG + Intronic
1023105806 7:36762333-36762355 ATTTAAAAATAAAAACAAAAAGG + Intergenic
1023736671 7:43241835-43241857 GTCAAAAAATAATAACTACAGGG + Intronic
1023910404 7:44551498-44551520 CTCTAAAAATAAAAATAAGTTGG + Intergenic
1024135159 7:46399445-46399467 TTTAAAAAATAATAATAATAGGG + Intergenic
1024348136 7:48334333-48334355 CTCAAAAAAAAAAAAAAATAGGG - Intronic
1024461193 7:49661273-49661295 CTCTAAACATAGTTAGAATACGG - Intergenic
1024799218 7:53057135-53057157 CTCTATAAATAAGAACTATTTGG + Intergenic
1025065419 7:55850698-55850720 TCCTAAAAATCATAAAAATAGGG - Intronic
1025203117 7:56974412-56974434 TTAAAAAAATAATAATAATAAGG + Intergenic
1025698367 7:63792758-63792780 CTCAAAAAATAAAAAAAAAATGG + Intergenic
1025729476 7:64097294-64097316 CTCTACAAAAAATAAAATTAAGG - Intronic
1025814279 7:64896235-64896257 CTCCAAAGGTAATAACAAAAAGG + Intronic
1025860482 7:65322232-65322254 CTCAAAAAAAAATAGAAATAAGG + Intergenic
1026015491 7:66668096-66668118 CTCTAAAAATAAGTAAAATGGGG - Intronic
1026350673 7:69512631-69512653 CTCAAAAAATAATAATAATAGGG + Intergenic
1026551290 7:71370770-71370792 CTCTACAAAAAATAAAAATAAGG - Intronic
1026780119 7:73260650-73260672 CTCAAAAAATAATAACAAAATGG - Intergenic
1026821552 7:73553085-73553107 CTCTACAAAAAATAAAAATTTGG - Intronic
1026949901 7:74340093-74340115 CAATAATAATAATAATAATAAGG + Intronic
1027020974 7:74814068-74814090 CTCAAAAAATAATAACAAAATGG - Intronic
1027067052 7:75131856-75131878 CTCAAAAAATAATAACAAAATGG + Intronic
1027374195 7:77535087-77535109 CTCAAAAAATAAAAATAAAAAGG - Intergenic
1027408267 7:77885743-77885765 CTGTTAAAAGTATAACAATAAGG - Intronic
1027801256 7:82753015-82753037 CACTAAAAATAAAAAGAAAAAGG + Intergenic
1027858386 7:83542335-83542357 GTCTCAAAATAATAATAATAAGG + Intronic
1027924663 7:84445922-84445944 CTCTTAAAATATCAACAAAATGG + Intronic
1028001981 7:85510007-85510029 CACTAATAATAATAAAAAAATGG + Intergenic
1029044203 7:97610444-97610466 CTCTGAAAATAAATACATTAGGG - Intergenic
1029086977 7:98019431-98019453 CTCAAAAAAAAACAACAAAAAGG - Intergenic
1029451565 7:100644198-100644220 CTCTACAAAAAATAAAAATTAGG - Intronic
1029929022 7:104351035-104351057 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
1030132133 7:106210592-106210614 GTCTAATAATAATAAAAAAAAGG - Intergenic
1030411975 7:109192286-109192308 CTATTAAAATAATCATAATATGG + Intergenic
1030428678 7:109414144-109414166 CTCTAAACATAAGAAAACTAGGG + Intergenic
1030665436 7:112272792-112272814 TTCTCAAAATACTAAAAATAAGG - Intronic
1030677727 7:112401913-112401935 CTCAAAAAAAAAAAAGAATATGG - Intergenic
1030801195 7:113854746-113854768 GTCAAAAAACAATACCAATATGG + Intergenic
1030951582 7:115797029-115797051 CCATAATAATAATAATAATAAGG - Intergenic
1031071668 7:117168778-117168800 CTTTAAAAAACAAAACAATATGG + Intronic
1031102929 7:117504753-117504775 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
1031487840 7:122350958-122350980 CTCTAAAAATAATTTAAAAAGGG + Intronic
1031787781 7:126056567-126056589 CTCTACTAAAAATACCAATATGG + Intergenic
1032134780 7:129266006-129266028 CTGTAAGTATAAAAACAATAGGG + Intronic
1032271030 7:130406282-130406304 TTTTAAAAATAATAATAACAGGG + Intronic
1032420714 7:131776953-131776975 CTCCAAATATAGTAACACTAGGG + Intergenic
1032600657 7:133290389-133290411 CTTTAATAATAATGACTATAGGG + Intronic
1033068498 7:138179664-138179686 CTCTTAAAAAAATAACAGAAAGG + Intergenic
1033360155 7:140633326-140633348 CTATAAAAATACAAACATTAGGG - Intronic
1033563529 7:142557056-142557078 CTAAAAAAATAATAATAATTTGG - Intergenic
1033634363 7:143196823-143196845 CTATAGAAATCAAAACAATATGG + Intergenic
1033889668 7:145995802-145995824 CTCTAAAAATGATAAACAAATGG - Intergenic
1035236772 7:157502419-157502441 TTCTGAAAATCATAAGAATAAGG - Intergenic
1035436416 7:158863463-158863485 CTCTTTAAATAATAATAATATGG + Intronic
1035879011 8:3223433-3223455 CGTTAAAAATAATAAAAATATGG - Intronic
1035910687 8:3562736-3562758 GGTTAAAAATAATAATAATACGG + Intronic
1035979275 8:4351150-4351172 CTCTAAAAAAAAAAAAAATTAGG + Intronic
1036015667 8:4780904-4780926 TTTAAAAAATAATTACAATAAGG - Intronic
1036117315 8:5972352-5972374 CTCAAAAAATAAAAAAAATTTGG - Intergenic
1036924738 8:12893298-12893320 CACAGAAAATAATAAAAATAAGG + Intergenic
1037593221 8:20331027-20331049 CTTTAAAAATATGAACAAAATGG + Intergenic
1037710400 8:21350993-21351015 ATTTAAAAATAATAATAAAAGGG + Intergenic
1037863958 8:22427996-22428018 CTCTATAAAAAATAAAAATCTGG + Intronic
1037871097 8:22497327-22497349 CTTTAAAAAAAAAAAAAATAGGG - Intronic
1038120694 8:24611258-24611280 CTCAAAAAATAATAATAATATGG + Intergenic
1038344228 8:26717525-26717547 CTCCAAACATAAGAACCATAAGG - Intergenic
1038759199 8:30371079-30371101 TTCTAATAAAAATGACAATAGGG + Intergenic
1038898886 8:31819237-31819259 CTCTAAAAATAAAATAAATTCGG + Intronic
1038987053 8:32822865-32822887 CATTAAAAATAAAAACAAAAAGG + Intergenic
1038989228 8:32847567-32847589 TTTTAAAAATATTAACAACATGG - Intergenic
1039232349 8:35462591-35462613 CTCTAACAATAATAATATTATGG + Intronic
1039619591 8:38984444-38984466 CTCTACAAAAAATAAAAATTAGG + Intronic
1039865147 8:41494314-41494336 CTTAAAAAATAATAATAATTAGG + Intronic
1040516395 8:48138567-48138589 CTCAAAAAATAAAAAAAAGATGG + Intergenic
1040984437 8:53278521-53278543 CACAGAAAATAATAAAAATAAGG + Intergenic
1041114209 8:54518752-54518774 CTCTAAATATCATCACATTAGGG - Intergenic
1041528872 8:58839889-58839911 AGCTAAAAATAATAAAAAGAAGG - Intronic
1041597252 8:59669484-59669506 TTCTTAAAATAATAACTTTACGG - Intergenic
1041640918 8:60200516-60200538 AGATAAAAATAATAACAAGAAGG + Intronic
1041646000 8:60253243-60253265 AAATAAAAATAAAAACAATATGG + Intronic
1042034446 8:64516085-64516107 CTTTAAAAATAATAACTTTGTGG + Intergenic
1042265249 8:66901928-66901950 CTCAAAAAAGAAAAAAAATATGG + Intronic
1042731624 8:71941538-71941560 TTATCAAAATAATAACAACATGG - Intronic
1043096667 8:75984219-75984241 CTCCAAAAAGTATTACAATATGG + Intergenic
1043155279 8:76771047-76771069 CTCTAAATAGAATGACCATATGG - Intronic
1043173763 8:76998816-76998838 TTCTAAAAATAAGGAGAATACGG + Intronic
1043364111 8:79511472-79511494 CTCTAAAAAAAAAAAAAAAAAGG + Intergenic
1043717042 8:83499762-83499784 GTCTCAAAAAAATAACAAAAAGG - Intergenic
1044169854 8:89036356-89036378 CTGTAAAAATAAGGAAAATAAGG + Intergenic
1044213631 8:89581313-89581335 CTCAAAAAAAAAAAAAAATATGG - Intergenic
1044702031 8:94973852-94973874 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
1045113620 8:98957204-98957226 CTCTAAAAAGAGTGAAAATATGG - Intergenic
1045316831 8:101050468-101050490 CTATAAAAATAATAATAACGGGG - Intergenic
1045609960 8:103827836-103827858 CTCAAAAAATAAAAAAAAGAAGG + Intronic
1045761707 8:105616664-105616686 CAATAATAATAATAATAATAAGG + Intronic
1046142291 8:110109579-110109601 TTCTAAAAATGAGAAAAATAAGG - Intergenic
1046317600 8:112527061-112527083 CAATAAAAAAAATAGCAATATGG + Intronic
1046987124 8:120400209-120400231 CTCTAAAACTGATCACAGTAAGG + Intronic
1047128699 8:121992987-121993009 CTCTAAAAATAATTACAATTAGG - Intergenic
1047569525 8:126082911-126082933 TAGTAAAAATAATAATAATAAGG - Intergenic
1047582697 8:126233768-126233790 CTCTAGAACTATTAACAACATGG + Intergenic
1047776086 8:128071740-128071762 CTCAACAAATTATAACTATACGG - Intergenic
1048039792 8:130716033-130716055 CTCTAAAAATTAAAAAAAAATGG + Intergenic
1048105828 8:131408217-131408239 CTCAAAAAAAACTAAAAATAGGG - Intergenic
1048148189 8:131866084-131866106 CTAAAATAATAATAATAATAAGG - Intergenic
1048193761 8:132314559-132314581 CTTTAATAACAAAAACAATAAGG + Intronic
1048408993 8:134151848-134151870 CTGTAAAAATCATAAGAATATGG + Intergenic
1048501883 8:134985348-134985370 CTTTGAAAATATTAACAAAATGG + Intergenic
1048692638 8:136985100-136985122 GTCTAAAAATGACAAAAATACGG - Intergenic
1049937611 9:514312-514334 CTCTAAAAATAATAGCTTCAGGG + Intronic
1050275684 9:3996354-3996376 CCATGAAAATAATAACACTAAGG + Intronic
1050332102 9:4555986-4556008 CTCAAAAAAAAAAAAAAATAGGG - Intronic
1050549782 9:6739073-6739095 GTCTCAAAATAATAATAATTAGG - Intronic
1050933624 9:11364488-11364510 CAATAATAATAATAATAATAAGG + Intergenic
1051008759 9:12383531-12383553 TTTTAAAAATAATATCAGTAGGG - Intergenic
1051178425 9:14384532-14384554 CTCTCAAAAAAAGAACCATATGG + Intronic
1051268569 9:15332515-15332537 ATTAAAAAATAATAAAAATAAGG + Intergenic
1051284315 9:15480392-15480414 CACTAAAGATAAAAACAAGAAGG + Intronic
1051611789 9:18968591-18968613 CTCAAAAAAAAAAAACAAAAAGG - Intronic
1052121321 9:24720746-24720768 TTGTAATAATAATAATAATATGG - Intergenic
1052297064 9:26908464-26908486 ATCTCAAAATAATAATAATAAGG - Intronic
1052310826 9:27067440-27067462 TTCTTAACATGATAACAATATGG + Intergenic
1052472699 9:28919765-28919787 TTCTAAAAATGAAAACAAAAAGG + Intergenic
1052598118 9:30588047-30588069 GTCATAAATTAATAACAATAAGG - Intergenic
1052899106 9:33774984-33775006 CTCAAAAAATAATAATAATGAGG + Intronic
1052909787 9:33870143-33870165 ATCTCAAAAAAATAAAAATAAGG - Intronic
1052976094 9:34411387-34411409 CTTTAAAAATAAAAAAAAAAGGG + Intronic
1053388329 9:37713804-37713826 CTCTAAAAATACAAACAATATGG + Intronic
1053618146 9:39791166-39791188 CTCTTAAAATAAAAATAAAAAGG - Intergenic
1053876320 9:42550536-42550558 CTCTTAAAATAAAAATAAAAAGG - Intergenic
1053896349 9:42744166-42744188 CTCTTAAAATAAAAATAAAAAGG + Intergenic
1054235377 9:62551185-62551207 CTCTTAAAATAAAAATAAAAAGG + Intergenic
1054266011 9:62916263-62916285 CTCTTAAAATAAAAATAAAAAGG + Intergenic
1054351742 9:64023140-64023162 CTCTAACAATAAAATGAATAAGG - Intergenic
1054733242 9:68722594-68722616 AAATAAAAATAACAACAATATGG - Intronic
1055041118 9:71873920-71873942 CTTGAAAAATAATTCCAATAAGG + Intronic
1055233854 9:74094968-74094990 CTCTAAAAAGCATTACAATGTGG - Intergenic
1055292136 9:74793153-74793175 CTCAAAAAATAATAATAATTGGG + Intronic
1055397162 9:75888507-75888529 TCTTAAAAATAATAATAATAGGG + Intergenic
1055440685 9:76333175-76333197 TTCTAAAAATTAAAACAATTTGG + Intronic
1055690922 9:78829814-78829836 CTTGAAAAATAATAACAATAAGG - Intergenic
1055814812 9:80192408-80192430 GTCAAATAATAATAATAATATGG + Intergenic
1056362752 9:85875151-85875173 TTTTAAAAATAATCATAATATGG - Intergenic
1056398360 9:86202526-86202548 CTCTAAAATTAATCATATTAAGG - Intergenic
1056531766 9:87494463-87494485 CTATAAAAATAATTATGATATGG - Intergenic
1056901040 9:90599701-90599723 CTCTTAAATTATTCACAATATGG + Intergenic
1057524818 9:95789356-95789378 ATGTGAATATAATAACAATACGG - Intergenic
1057779641 9:98039149-98039171 CTCTAAAAGTAAAAATAAGAGGG - Intergenic
1058508496 9:105691133-105691155 CTCTATTAATACAAACAATATGG - Intergenic
1058570956 9:106343107-106343129 ATCAGAAAATAATAACAAAATGG + Intergenic
1058696526 9:107563815-107563837 CTCTAAAAAAAAAAATAAAATGG + Intergenic
1058707768 9:107651508-107651530 CTGTAAAAACAAGAAGAATAAGG - Intergenic
1058771066 9:108232286-108232308 CTCAAAAAATAAGAAAAACATGG + Intergenic
1058772793 9:108253865-108253887 CTCTAAAAAGCATTACAATTTGG + Intergenic
1058784724 9:108375762-108375784 CTGTAAAAGCAGTAACAATAAGG + Intergenic
1058840626 9:108904525-108904547 AACTAAACATTATAACAATAGGG + Intronic
1059258758 9:112955613-112955635 CTCAAAAAATATTATCAATAGGG + Intergenic
1061208832 9:129179098-129179120 AACTAATAATAATGACAATAGGG + Intergenic
1061268797 9:129524464-129524486 CTCTAAAAAGAAAAAAAAAAAGG - Intergenic
1061764393 9:132872329-132872351 CTCTAAAAAGAAAAATAAGAGGG + Intronic
1062611613 9:137377442-137377464 CTCTAAAAAAAAAAAAAAAAAGG + Intronic
1186111634 X:6263674-6263696 CTTTAGAAATAATAATACTAAGG - Intergenic
1186129356 X:6449513-6449535 CACTAAAAATAATTACATTTGGG - Intergenic
1186984312 X:14995293-14995315 ATCTAAATATTATATCAATATGG + Intergenic
1187200507 X:17129677-17129699 CTCTAAAAACACAAACAATAGGG - Intronic
1187276944 X:17824555-17824577 CTTTAAAAAAAATCACAGTAAGG + Intronic
1187289114 X:17935168-17935190 CTCTAAAAAAAATAAAAAGAAGG - Intergenic
1187325301 X:18281291-18281313 CTTTGAAATTAATAAAAATAAGG + Intronic
1187484629 X:19691117-19691139 ATTTAAAAATAATAATAAAATGG - Intronic
1187634202 X:21209198-21209220 CACTAAAAATAAAAAAAACAAGG + Intergenic
1187646725 X:21355348-21355370 CTCAATAAATAATAACAAATTGG + Intergenic
1187795592 X:23000213-23000235 CTTTAAAATAAAGAACAATATGG + Exonic
1187893040 X:23955224-23955246 GTCTAAAAATAAAAAAAATTGGG - Intergenic
1188279175 X:28242106-28242128 CTTTAAAAACACCAACAATATGG - Intergenic
1188363547 X:29286376-29286398 CTCTTAAAAAAATAAAAATTTGG + Intronic
1188502464 X:30842830-30842852 AAATAAAAATAATAAAAATATGG + Intronic
1188594795 X:31886271-31886293 CTATAAAAGTAATGAAAATATGG + Intronic
1189227772 X:39427660-39427682 CTCTAAAAATAATCAGAGTGTGG + Intergenic
1189610552 X:42729500-42729522 ATGTAAAAATAATAAAAAGAGGG + Intergenic
1189627463 X:42914566-42914588 GTATAAAAATAATAGAAATAAGG + Intergenic
1190015627 X:46824527-46824549 CTCGACAAATAATAAAAAGATGG - Intergenic
1190159560 X:48021480-48021502 CTCTCAAGAAAATAACAGTAGGG + Intronic
1190489452 X:50966936-50966958 CTCCAAATATAATCACACTAGGG - Intergenic
1190538746 X:51456136-51456158 CTCAAAAAAAAAAAAAAATACGG + Intergenic
1190631227 X:52388651-52388673 CTCTACAAATATTAAAAATGAGG + Intergenic
1190883675 X:54511844-54511866 CTCTACAAAAAATAATAATAAGG + Intergenic
1191014719 X:55796581-55796603 ATCTAAACATAGTAAAAATATGG + Intergenic
1191081486 X:56515055-56515077 CAGAAAAAATAATAACAAAATGG + Intergenic
1191179371 X:57543286-57543308 CACAGAAAATAATAACAAAATGG + Intergenic
1191207040 X:57845685-57845707 CTATAAAAACAATAAAAAAAGGG + Intergenic
1191664765 X:63689089-63689111 ATCAGAAAATAATAACAAAATGG + Intronic
1192262777 X:69517334-69517356 CAATAATAATAATAACAATGGGG - Intronic
1192379160 X:70597326-70597348 CTTTAAAAAGAAGAACAATGAGG + Intronic
1192403449 X:70860001-70860023 CTCTCAAAATAAAAATTATAAGG + Intronic
1192462360 X:71328235-71328257 GTCTCAAAAAAATAATAATAAGG + Intergenic
1192586892 X:72326242-72326264 CTCAAATAATAATAATAATATGG - Intergenic
1192700908 X:73471185-73471207 CTTTGAAATTAATAAAAATAGGG - Intergenic
1192751059 X:73991856-73991878 GTCTCAAAAAAATAAAAATACGG - Intergenic
1192908272 X:75576178-75576200 CTGGAAAACAAATAACAATATGG - Intergenic
1193266440 X:79476693-79476715 CTCTGAAAATATAAACAAAATGG - Intergenic
1193576635 X:83206799-83206821 CAGTAATAATAATAACAACAAGG + Intergenic
1193605149 X:83558036-83558058 CTATAGGAATAAAAACAATATGG - Intergenic
1193842986 X:86431950-86431972 CTGTAAAAACTCTAACAATATGG - Intronic
1193906131 X:87246486-87246508 CTTTTAAAATAACAAAAATATGG - Intergenic
1194079683 X:89444443-89444465 CTTATAAAATAATAAAAATATGG + Intergenic
1194218572 X:91164108-91164130 CTAGAAAAATAATAAGAAAATGG - Intergenic
1194336156 X:92648913-92648935 CTCTAAAAATATTTAAAAAATGG + Intergenic
1194540529 X:95164814-95164836 CTCTAACAATCATAACTTTACGG - Intergenic
1194792781 X:98171549-98171571 CTCAATAAATCTTAACAATAAGG + Intergenic
1194914451 X:99687873-99687895 ATTTAAAACAAATAACAATATGG - Intergenic
1195228392 X:102821564-102821586 CTCTAAAAATATTACCCACAAGG - Intergenic
1195437810 X:104865386-104865408 ATCTTCAAATAACAACAATAAGG - Intronic
1196410000 X:115408328-115408350 CTCTAATAAAAGGAACAATATGG - Intergenic
1196558148 X:117115805-117115827 CTCTAAACATAATAAACATCAGG + Intergenic
1196770282 X:119286731-119286753 CTCTAAAAAAAAAAAAAAAAAGG - Intergenic
1197031342 X:121819621-121819643 CTATAAAAATAATAATAAAAAGG + Intergenic
1197070350 X:122289286-122289308 CTTTTAAAATAATAACAGAAAGG + Intergenic
1197328815 X:125127973-125127995 CTCTAAAAATTATGTCAATAAGG + Intergenic
1197400492 X:125983474-125983496 ATCAAAAAATATTAACAATTTGG + Intergenic
1197445181 X:126545028-126545050 TACTAAAAATAATGAGAATATGG - Intergenic
1197483798 X:127021532-127021554 CTCTACAACAAATGACAATAGGG + Intergenic
1198064915 X:133086609-133086631 CTTAAAAAGTAATAATAATAAGG + Intronic
1198364030 X:135923187-135923209 CTCTAAAAGTCATTACAGTATGG + Intergenic
1198444557 X:136699207-136699229 TTATAATAATAATAACAAAAAGG + Intronic
1198910752 X:141611191-141611213 GACAAAAAATAATAATAATAAGG - Intronic
1199177279 X:144804560-144804582 TTCTACAAATATTAAGAATAAGG + Intergenic
1199217232 X:145273999-145274021 CTATTAATATAATAACAATAGGG + Intergenic
1199272892 X:145905879-145905901 CTCTAACAACAACAACAAAAAGG + Intergenic
1199471814 X:148204097-148204119 CTTCAAAAGTAATAATAATACGG + Intergenic
1199903795 X:152204421-152204443 CTATAAACATAATAACTACATGG - Intronic
1199918307 X:152369003-152369025 CTCAAAAAAAATTAAAAATAGGG - Intronic
1200364114 X:155643493-155643515 CTAGAAAACAAATAACAATATGG - Intronic
1200432304 Y:3099747-3099769 CTTATAAAATAATAAAAATATGG + Intergenic
1200555085 Y:4627865-4627887 CTAGAAAAATAATAAGAAAATGG - Intergenic
1200644590 Y:5765660-5765682 CTCTAAAAATATTTAAAAAATGG + Intergenic
1200658361 Y:5932462-5932484 CTTTAACAACAATAACAACATGG + Intergenic
1200842729 Y:7799880-7799902 CTGTTAAAATAATAATAGTAAGG - Intergenic
1201325000 Y:12747032-12747054 CTTTAAAAATAAAAACATTCTGG - Intronic
1201433202 Y:13927057-13927079 CTCAAAAAACAAAAACAAAATGG - Intergenic