ID: 1127455588

View in Genome Browser
Species Human (GRCh38)
Location 15:59153582-59153604
Sequence AATCTTACCCTGCAGCTCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127455587_1127455588 -9 Left 1127455587 15:59153568-59153590 CCAGAGGATGTGAGAATCTTACC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 158
1127455586_1127455588 1 Left 1127455586 15:59153558-59153580 CCGGCTTCATCCAGAGGATGTGA 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127455588 Original CRISPR AATCTTACCCTGCAGCTCCC TGG Exonic
902584134 1:17427724-17427746 CATCTTTCCCTGCAGTGCCCAGG + Intronic
902614871 1:17618353-17618375 AATGTTACCCAGCAGCTCGTGGG + Intronic
902975142 1:20083095-20083117 AATCTTTCTCTGCTGCTCCCTGG - Intronic
905331542 1:37204226-37204248 AATCTTTCCCTGCAGCTTGAAGG - Intergenic
906798283 1:48714647-48714669 AATCTGACCATGCCGCTTCCTGG + Intronic
907566837 1:55443364-55443386 ACTATTACCCTGCTGCTCTCTGG + Intergenic
911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG + Intergenic
911857460 1:102898142-102898164 CATCTTGGCCTGCAGCTCCAGGG + Exonic
913488603 1:119357224-119357246 AATCTTTCTCAGAAGCTCCCAGG + Intergenic
915666287 1:157448171-157448193 AATCTTACCTGGCAGCTGCTGGG + Intergenic
920116203 1:203623518-203623540 GATCTTCCCCTCAAGCTCCCTGG - Intergenic
920251222 1:204623656-204623678 TAGCTTTCTCTGCAGCTCCCCGG - Intronic
924798452 1:247309844-247309866 AATCTGATCCTGCAGCAACCAGG + Intronic
1064500630 10:15968978-15969000 CCTCTTACCCTCCAGGTCCCAGG - Intergenic
1064860835 10:19823604-19823626 AATCTCAACCTCCACCTCCCGGG - Intronic
1070503200 10:77090591-77090613 ATGCTTCCCCTGCAGCTGCCTGG - Intronic
1070824750 10:79384618-79384640 AAATCCACCCTGCAGCTCCCTGG + Exonic
1072630195 10:97140306-97140328 TTTGTTACCCTGCAGCTCTCAGG + Intronic
1073542283 10:104323960-104323982 AATGTTCTCCTGCAGCCCCCAGG + Intronic
1074689863 10:115994629-115994651 AATCTTACTTTGCAGTTCCAGGG + Intergenic
1075168501 10:120091420-120091442 AGTCTTCCCCAGCAGCTCCCTGG - Intergenic
1077047192 11:551845-551867 AAGCTGACCCTGCAGCCCCTCGG + Intronic
1078086620 11:8237241-8237263 GATCCTACCCTGCAGTTCCCGGG - Intronic
1079477929 11:20850728-20850750 CATCTTTCCAAGCAGCTCCCAGG - Intronic
1083782524 11:64925661-64925683 AGTCTCACCCAGCACCTCCCAGG + Exonic
1084420072 11:69056062-69056084 AAACGTAGCCTGCACCTCCCTGG - Intronic
1084979915 11:72823542-72823564 AGTCTTTCCTTGCAGGTCCCTGG + Intronic
1088717989 11:112565552-112565574 AATTTTACCCAGAAGCTGCCAGG + Intergenic
1088817412 11:113431238-113431260 AATCTAATCCTGTAGCTGCCAGG + Intronic
1090165312 11:124540519-124540541 AATGTTACCCTGTGGCTCCAGGG + Intergenic
1090705403 11:129331897-129331919 TATCTTAACAAGCAGCTCCCCGG + Intergenic
1094019878 12:25902819-25902841 AATCTTTGCCACCAGCTCCCAGG - Intergenic
1095404329 12:41851216-41851238 CCTCTTACCTTGCAACTCCCAGG + Intergenic
1097447647 12:59692270-59692292 AATCTTACCCTGGATTACCCAGG - Intronic
1098441283 12:70521820-70521842 AATCTTAGCCTTCAGCTACGTGG + Intronic
1103222236 12:119255465-119255487 AATCTAACCCAGCAGTCCCCTGG + Intergenic
1103616712 12:122158056-122158078 AATCTTAGCCTTGACCTCCCAGG - Intergenic
1104715431 12:131013090-131013112 AATCTTGCCCTTCAGGTACCTGG + Intronic
1109262783 13:60163764-60163786 CATCTTTCCCCGCAGCTCCGGGG + Exonic
1112566236 13:100553158-100553180 GATCTTGCCATGCACCTCCCAGG - Intronic
1112852858 13:103728395-103728417 AATCTTACCCTGAATCTCTTAGG + Intergenic
1113451235 13:110411416-110411438 AGTATTAGCCTGCAGCTCCAGGG + Intronic
1113486658 13:110657880-110657902 AACCTGACCTTGCAGCCCCCAGG + Intronic
1116937514 14:50757430-50757452 AATCTGATTCTTCAGCTCCCAGG + Exonic
1119430129 14:74561846-74561868 TATCTATCCCTGAAGCTCCCTGG - Intronic
1122859948 14:104578027-104578049 TATCTTGCCCTGCAGAGCCCAGG + Intronic
1122961338 14:105094805-105094827 AATCTGACCCTGTCACTCCCCGG - Intergenic
1127263890 15:57345982-57346004 AATATTACCCAGAAGCTTCCTGG - Intergenic
1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG + Exonic
1129905841 15:79186622-79186644 AATCTGACCCTGACACTCCCTGG + Intergenic
1129907663 15:79200510-79200532 AACCTTCCCCTGCAGCACACAGG - Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132842645 16:1985688-1985710 GGGCTGACCCTGCAGCTCCCCGG - Intronic
1133782733 16:8952489-8952511 AATGTTTCCCTGCCGCTTCCGGG + Intronic
1135396351 16:22134619-22134641 AATCTTTCCTTGCCCCTCCCTGG + Intronic
1136394248 16:29984216-29984238 GATCTTACCCTTCCCCTCCCAGG - Intronic
1138635803 16:58337409-58337431 AATCTTACCTTTGAGCTCCAAGG - Intronic
1139527581 16:67526294-67526316 ACTCCCAGCCTGCAGCTCCCTGG - Intronic
1140937876 16:79691519-79691541 AATCTGACCCTGTAGTTCTCTGG - Intergenic
1143945511 17:10588315-10588337 ATTATTACCCTGGACCTCCCTGG + Intergenic
1146172560 17:30645104-30645126 AATCATTCCCTGCCCCTCCCTGG + Intergenic
1146346014 17:32061113-32061135 AATCATTCCCTGCCCCTCCCTGG + Intergenic
1148190118 17:45672414-45672436 GATCTGAGCGTGCAGCTCCCAGG - Intergenic
1150205249 17:63399936-63399958 ACTCTTAAGCTGCAGCTGCCAGG - Intronic
1151234051 17:72705690-72705712 AATGTGACCCAGCAGTTCCCTGG + Intronic
1151579169 17:74968485-74968507 CATGTTACCCTGCAGCTCCCTGG - Intronic
1151666055 17:75545641-75545663 GATCTGACCCTGCGGCTCCAGGG + Intronic
1151803258 17:76390221-76390243 TTGCTTTCCCTGCAGCTCCCTGG + Exonic
1152647912 17:81478458-81478480 AATCTTAAGCTGCAGATCACTGG - Intergenic
1157406497 18:47426357-47426379 AGTCTTACCCTCCAGGTTCCTGG - Intergenic
1161389841 19:4015255-4015277 AAGCCTGCCCTGCCGCTCCCAGG - Intronic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
1161998856 19:7730859-7730881 CCTCTCACCCTGCGGCTCCCAGG - Exonic
1162152627 19:8656657-8656679 AATGTTTCCCTGCTGCGCCCAGG + Intergenic
1162866673 19:13553183-13553205 AATCCCACCCTTCAGCCCCCAGG - Intronic
1162989876 19:14294976-14294998 AATCATTCCCTGCCCCTCCCTGG - Intergenic
1163776932 19:19224419-19224441 AGACTTACCCCCCAGCTCCCGGG - Exonic
1166098618 19:40557261-40557283 AATCTGTCCCTGAAGCTCTCGGG - Exonic
1167348125 19:48959403-48959425 ATTCTTACCCTTCAGCTCTCAGG - Intronic
1167420914 19:49402729-49402751 AAACTTTCCCTGAAGCCCCCTGG + Intronic
1168121243 19:54253741-54253763 GCTCTTTCCCTGCAGCTCCGGGG - Intronic
1168124736 19:54277199-54277221 GCTCTTTCCCTGCAGCTCCGGGG - Intronic
1168177251 19:54634349-54634371 GCTCTTTCCCTGCAGCTCCGGGG + Intronic
925429605 2:3779790-3779812 AAACTTGCCCTGCAGCTTCCTGG + Intronic
925519210 2:4723067-4723089 AATCATAACCTGCAGATACCGGG - Intergenic
927152662 2:20204705-20204727 TATCCTACCTTGCAGCTCTCAGG + Intronic
929077819 2:38092875-38092897 CATTTTACCCCGTAGCTCCCGGG - Intronic
937476918 2:122223759-122223781 TATCTTCCCCTGGGGCTCCCCGG + Intergenic
942318451 2:174715157-174715179 ACTCTTCCCCTGGAGCCCCCAGG - Intergenic
942698075 2:178668704-178668726 AATCTCACTCTGCTGCACCCAGG - Intronic
947744344 2:232499914-232499936 ATTCTTACTCTGCAGTCCCCCGG - Intergenic
947744371 2:232499989-232500011 ATTCTTACTCTGCAGTCCCCCGG - Intergenic
947949673 2:234136251-234136273 AGGCCTACCCTGCAGCCCCCAGG + Intergenic
1169052666 20:2594057-2594079 AGGCTTACTCTGCAGCTCCAAGG + Intronic
1169129006 20:3153659-3153681 GTTCTAACCCTCCAGCTCCCTGG - Intronic
1169140929 20:3227200-3227222 ACGCTTTCCCTGCAGGTCCCTGG + Intergenic
1170044896 20:12074535-12074557 ACTCTCCCCCTCCAGCTCCCAGG - Intergenic
1170368701 20:15624865-15624887 AATCTAACCCTACAGAGCCCAGG + Intronic
1171426238 20:25050534-25050556 AATTTGACCCTGGAGCCCCCCGG + Intronic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1178130352 21:29565024-29565046 AGACTTCCCCTGTAGCTCCCTGG - Intronic
1182295341 22:29308792-29308814 AATCTGTCCCTGAACCTCCCAGG + Intronic
1184504752 22:44893895-44893917 AGCCTCACCCTGCAGCTCACTGG - Intronic
949164312 3:919969-919991 GAACTTCTCCTGCAGCTCCCTGG + Intergenic
951487683 3:23232107-23232129 AACCTTACCCTTCAACTTCCAGG - Intronic
952072078 3:29649292-29649314 AATCTTGCTCTGCAGCTCTGGGG + Intronic
952889094 3:38029335-38029357 AATCTCAGCCCGCGGCTCCCTGG - Intronic
954220941 3:49153577-49153599 ACTCTTATCCTTCAGCTCCATGG - Intergenic
954868859 3:53751647-53751669 GAGCTCACCCTACAGCTCCCGGG - Intronic
956890247 3:73606381-73606403 AGTCTGACCCTGCTGCTTCCTGG + Intronic
965376802 3:167934878-167934900 ACTCTTACTCTGGAGCTTCCTGG - Intergenic
967075129 3:185994925-185994947 AAACCTACCCTGTTGCTCCCAGG - Intergenic
968420442 4:479547-479569 AATCTGTGCCTGCAGCCCCCTGG - Intronic
969359163 4:6650737-6650759 AATCTTTCCTTGCTTCTCCCTGG + Intergenic
970063974 4:12069800-12069822 ATTACTACCCTGCAGCTCCCTGG - Intergenic
973734951 4:53862472-53862494 AATTTTCTCCAGCAGCTCCCTGG - Intronic
978342501 4:107733579-107733601 AATCTTACCCAGCAGCTGCTGGG - Intergenic
979504878 4:121484871-121484893 CATCTTGCCCTCCAGCTCTCTGG - Intergenic
986911880 5:12567415-12567437 ACTCTAACCCTGCATATCCCAGG - Intergenic
989165219 5:38427048-38427070 GATCTTACGCTGCAACTCCCTGG + Exonic
992869601 5:80993175-80993197 AGTCTAAGCCTGCACCTCCCTGG + Intronic
997589349 5:135063439-135063461 CATCTTGGGCTGCAGCTCCCAGG + Intronic
1003328042 6:5107638-5107660 GCTCTAACACTGCAGCTCCCAGG + Intronic
1004484172 6:16049954-16049976 AATCTTACCAAGGAGCTCCTGGG - Intergenic
1005385376 6:25279821-25279843 AATCTTACCTATCAACTCCCTGG - Exonic
1007160371 6:39787124-39787146 AATTTTACCCTGAAGCTAACTGG + Intergenic
1007269748 6:40627568-40627590 ATGTTTACCCTTCAGCTCCCAGG - Intergenic
1008552814 6:52649180-52649202 AATAGTTCCCTGGAGCTCCCTGG + Intergenic
1010288041 6:74102216-74102238 AATCCTATCCTTCAGCGCCCCGG - Intergenic
1011616223 6:89200648-89200670 AAGCTTAGCCTGCAGCTACTGGG - Intronic
1012024696 6:93973649-93973671 AATCCTTCCCTGCCTCTCCCCGG - Intergenic
1013406569 6:109849124-109849146 GATCTTACCCTAGAGCTCTCGGG - Intergenic
1014871584 6:126602980-126603002 AATCTGGACCTGCAGCTCCCAGG + Intergenic
1017451877 6:154561954-154561976 AATCTCAACCTGCAACTCACTGG + Intergenic
1017515399 6:155151918-155151940 CATCTTAACCTCCACCTCCCAGG + Intronic
1019583962 7:1786240-1786262 AATCTCAACCTCCATCTCCCGGG + Intergenic
1019938988 7:4274410-4274432 ACGTTTACCCTGAAGCTCCCAGG + Intergenic
1021657435 7:22886027-22886049 ATTCTTTCCCTGAAGCCCCCAGG - Intergenic
1021866905 7:24967309-24967331 ATTCTTACCCTACAGCTGCAAGG + Intronic
1025858305 7:65303677-65303699 AATCTTATCCAGCAGCTTCTGGG - Intergenic
1033459740 7:141535248-141535270 CATCTTAACCTGCCCCTCCCAGG + Intergenic
1035270563 7:157717431-157717453 CAGCTGACCCTGCAGCACCCAGG - Intronic
1035452369 7:158985738-158985760 GATCTGACCCTGCAGCTGGCTGG - Intergenic
1035470708 7:159106997-159107019 AACCTTTCTCTGCACCTCCCTGG - Intronic
1037114764 8:15210977-15210999 AATTTTCCCCTGCAACACCCAGG + Intronic
1038021856 8:23557694-23557716 AGCCTCACCCTGCAGCCCCCTGG - Intronic
1040637427 8:49291172-49291194 AATCCTAGCATTCAGCTCCCAGG - Intergenic
1040991252 8:53352656-53352678 AATCTCACCCGGCAGCTGCTGGG + Intergenic
1041433759 8:57815617-57815639 ATTATGACCCTGCAGCTCTCTGG - Intergenic
1042474993 8:69237928-69237950 AATCTTATCATGGAACTCCCTGG + Intergenic
1047769320 8:128017935-128017957 CATCTTACCCTCCTGCGCCCTGG + Intergenic
1049027397 8:140004186-140004208 AATCATGCTCTGCATCTCCCCGG - Intronic
1049100480 8:140575265-140575287 AATCTCACCTGGCACCTCCCTGG + Intronic
1049100489 8:140575300-140575322 AATCTCACCTGGCACCTCCCTGG + Intronic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1053562792 9:39213117-39213139 ATCCTTACCCTCCAGCTCCTTGG - Intronic
1053828595 9:42051082-42051104 ATCCTTACCCTCCAGCTCCTTGG - Intronic
1054134358 9:61405925-61405947 ATCCTTACCCTCCAGCTCCTTGG + Intergenic
1054601966 9:67136372-67136394 ATCCTTACCCTCCAGCTCCTTGG + Intergenic
1054823013 9:69543007-69543029 ACTCTTACTCTGCAGCTGGCTGG - Intronic
1056280207 9:85034477-85034499 AATACAAACCTGCAGCTCCCAGG - Intergenic
1060256585 9:122036060-122036082 GCTCTCACCCTGCTGCTCCCTGG + Intronic
1060799290 9:126533399-126533421 AGTCTTGCTCTGCAGCTCACGGG + Intergenic
1061393460 9:130330477-130330499 AACCTGACCCTGCAGCTCTTGGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1187744327 X:22391561-22391583 AATCTTACCCTGTCGTGCCCAGG - Intergenic
1190263956 X:48816509-48816531 ACTCTCACGGTGCAGCTCCCGGG - Exonic
1192194038 X:69016766-69016788 AATCTTCCCTGGCAGCTCCGTGG - Intergenic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1199848793 X:151710727-151710749 ACTCTTTCCCACCAGCTCCCAGG + Intergenic