ID: 1127456208

View in Genome Browser
Species Human (GRCh38)
Location 15:59158278-59158300
Sequence CTGGCTTACCTGGGGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127456201_1127456208 -5 Left 1127456201 15:59158260-59158282 CCAGACTACGGTACGTAGCTGGC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 426
1127456197_1127456208 10 Left 1127456197 15:59158245-59158267 CCAGATTTAGTGGTCCCAGACTA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 426
1127456199_1127456208 -4 Left 1127456199 15:59158259-59158281 CCCAGACTACGGTACGTAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 44
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127456208 Original CRISPR CTGGCTTACCTGGGGGAGGA GGG Exonic
900207758 1:1438884-1438906 GTGCCTTGGCTGGGGGAGGACGG - Intronic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900449211 1:2697236-2697258 CTTGCTCACCTGGGGGTGCAGGG - Intronic
900484497 1:2914996-2915018 CTGGCTTAGCTCCGGGGGGAGGG + Intergenic
900514272 1:3073856-3073878 CTGGCCTCCCTTGCGGAGGAGGG + Intronic
900647724 1:3716524-3716546 GTGGCTTCCCTGGGGCAGGGAGG + Intronic
900858387 1:5204772-5204794 CCGCCTTTCCTGGGGTAGGAGGG + Intergenic
901600445 1:10419526-10419548 CAGGCTTACCTGGATGAGGCTGG - Exonic
901726582 1:11247725-11247747 CTGGCACACCTGAGAGAGGAAGG + Exonic
902112494 1:14094097-14094119 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
902205499 1:14865459-14865481 ATGGCAGACATGGGGGAGGAGGG - Intronic
902236774 1:15062787-15062809 CTGCCTTACGTGGGTGTGGAGGG - Intronic
902292205 1:15442674-15442696 CTGGCTTTCCAGGGTGAGGATGG - Intronic
902656818 1:17874759-17874781 CTCGCCTGCCTGGGGCAGGAGGG + Intergenic
902805320 1:18857710-18857732 TTGGCTTTCCTGTGGCAGGAAGG - Intronic
902919545 1:19657787-19657809 TTGGCTTGCCTGGTGGGGGAAGG + Exonic
903321494 1:22546060-22546082 TTGCCTTTCCTGGGGGAAGAGGG - Intergenic
903369621 1:22826817-22826839 CTTGCTGTCCTGGGGGAGGCAGG - Intronic
904309505 1:29619190-29619212 GTGGCCTACCTGAGGGTGGAAGG + Intergenic
904315563 1:29658058-29658080 CTGGCTCAGCTGGGGCTGGATGG - Intergenic
904449615 1:30602368-30602390 TTGGTTTTCCTGGGAGAGGAGGG + Intergenic
904613203 1:31736382-31736404 CAGGCAGACCTGGGGGAGCAGGG + Exonic
904900533 1:33853749-33853771 CTGGCTTCTTTGGGGGAGGCAGG + Intronic
905232631 1:36524003-36524025 CTGGCTTTCCTGGAAGAGAATGG + Intergenic
905259305 1:36706305-36706327 CTGGCTTACCTGGCACAGGATGG - Intergenic
905557656 1:38899870-38899892 CTGCCCTTCCTGGGGCAGGAGGG + Intronic
906155860 1:43613604-43613626 CTCGCATACCTAGGGGAGGTAGG - Exonic
912611218 1:111046680-111046702 GTGGCCTACCTGAGGGTGGAGGG - Intergenic
913245737 1:116868554-116868576 CTGGCTTCCCTGGGGGATGCAGG - Intergenic
913695235 1:121318222-121318244 CTGGCTTATCTGGGTCAGCAAGG + Intronic
914142329 1:144961838-144961860 CTGGCTTATCTGGGTCAGCAAGG - Intronic
915340922 1:155176218-155176240 CTGGCTCACCTTGGGTCGGAAGG - Exonic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
915518854 1:156429774-156429796 CTTGCTTCCCTTGGGGACGAGGG - Intronic
915547512 1:156609748-156609770 CAGGCCTACTTGAGGGAGGAGGG + Intergenic
916287774 1:163129751-163129773 ATGGCTCACCTGGGAGAAGATGG + Intronic
919746935 1:201014552-201014574 CGGGCTTAGGAGGGGGAGGATGG + Intronic
920031371 1:203039229-203039251 GGGCCTTACCTGGGGGAGGGCGG - Intronic
920387619 1:205579936-205579958 CGGGCTTACCTGGAGGAAGACGG - Exonic
920482566 1:206336601-206336623 CTGGCTTATCTGGGTCAGCAAGG + Intronic
922395427 1:225195493-225195515 GGGGCTTACTTGGTGGAGGATGG + Intronic
922473518 1:225890705-225890727 CTGGCCCACCAGGGGCAGGAGGG - Intronic
922474739 1:225899174-225899196 CTGGCCTATCAGGGGCAGGAGGG + Intronic
923242262 1:232097368-232097390 CTGGCTGCCCTGGGGGAGGAAGG + Intergenic
923375449 1:233357656-233357678 CTGGCATGCATGGGAGAGGATGG + Intronic
923859546 1:237879433-237879455 CTGGCTAACACAGGGGAGGAGGG + Intronic
924441317 1:244087738-244087760 AAGGCTTCCCTGTGGGAGGAAGG - Intergenic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1063643769 10:7857963-7857985 CTGAATTATCTGGGGGAGGTAGG + Intronic
1063960046 10:11299458-11299480 CTGGCCTTCCTGGGGGGGGTTGG - Intronic
1063960957 10:11305125-11305147 TTGGATTTCCTGTGGGAGGAGGG - Intronic
1064651526 10:17514651-17514673 CTGGCCTATCTGGGTGTGGAGGG + Intergenic
1064732447 10:18346582-18346604 GTGGCTTTTTTGGGGGAGGAGGG + Intronic
1065864941 10:29906406-29906428 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067582643 10:47455365-47455387 CTGGTTTCCCTGGATGAGGACGG + Intergenic
1067722221 10:48736787-48736809 CTGCCTTACCTGGTTGAGGAAGG + Intronic
1067919453 10:50438491-50438513 CTGTCTTACCTGAGGCTGGATGG - Intronic
1069024863 10:63528604-63528626 CTGGCTTTCCTGAGTGAGGCAGG - Intronic
1073100958 10:101006471-101006493 CTGGCACACCTGGGGGTGGGAGG - Exonic
1073542741 10:104326357-104326379 CTGTCCTTCCTGGGAGAGGATGG - Intronic
1073607977 10:104915081-104915103 CTGCCTTCCATGGTGGAGGAGGG - Intronic
1076025573 10:127109544-127109566 CGGGGTTACCTGGGCTAGGAAGG - Intronic
1076149921 10:128153537-128153559 CTGGCTTACCTAGGGAAGAGAGG - Intergenic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1078080013 11:8197363-8197385 GTGGCTCACCTAGGAGAGGAAGG - Intergenic
1078456839 11:11482249-11482271 CTGGCACAGCTGGGGGAGGATGG - Intronic
1078992365 11:16662853-16662875 CTGGCTTTTTTGGGGGAGGCGGG + Intronic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1079224710 11:18595393-18595415 CTGCCAAACCTGGGGGAGGTGGG - Intergenic
1079870564 11:25793794-25793816 CTGCCTTTCCTGTAGGAGGAGGG + Intergenic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1081856590 11:46307987-46308009 CAGGCTCACCTGGTGGGGGATGG - Exonic
1083322790 11:61857548-61857570 CTGGCTTGGCATGGGGAGGAGGG + Intronic
1083581301 11:63827143-63827165 CTTGCTTTCCTGGGGAGGGAGGG + Exonic
1083618960 11:64039605-64039627 CAGGCTGTCCGGGGGGAGGAGGG - Intronic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1084117125 11:67049004-67049026 CTGGCCTACCGGGAGGAGCAGGG - Exonic
1084531310 11:69729465-69729487 CTGGGGTCCCTGGTGGAGGAGGG - Intergenic
1084841482 11:71854526-71854548 AAGGCCTACCTGGGGGTGGAGGG + Intergenic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085709912 11:78819912-78819934 CTGGCTTCCCCAGAGGAGGATGG + Intronic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1087057677 11:93949555-93949577 CTGGCTTACCTCTGGGAGTGTGG + Intergenic
1088814375 11:113411195-113411217 CTGGCTAACCTGGGTCAGAATGG - Intronic
1089555741 11:119315255-119315277 CGGGCACACCTGGGGGAGGGAGG + Exonic
1090275098 11:125413445-125413467 CCAGCCTACCTGTGGGAGGAAGG + Intronic
1090404646 11:126469431-126469453 CTTGCAGCCCTGGGGGAGGAGGG + Intronic
1091998674 12:5015863-5015885 CTGGCTCACCTGAGGGCAGAGGG - Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092704318 12:11267447-11267469 CTGGCTTTCCTGGACGAGGTGGG + Exonic
1092704338 12:11267510-11267532 CTGGCTTTCCTGGACGAGGTGGG + Exonic
1092704502 12:11268014-11268036 CTGGCTTTCCTGGACGAGGTGGG + Exonic
1092704522 12:11268077-11268099 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708320 12:11308496-11308518 CTGGCTTTCCTGGATGAGGTGGG + Exonic
1092708340 12:11308559-11308581 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708360 12:11308622-11308644 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708378 12:11308685-11308707 CTGGCTTTCCTGGATGAGGTGGG + Exonic
1092708398 12:11308748-11308770 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708419 12:11308811-11308833 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708437 12:11308874-11308896 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092712469 12:11353382-11353404 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092712525 12:11353565-11353587 GTGGCTTTCCTGGAGGAGGTGGG + Intronic
1092712580 12:11353748-11353770 GTGGCTTTCCTGGAGGAGGTGGG + Intronic
1092712638 12:11353931-11353953 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716207 12:11393102-11393124 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716259 12:11393288-11393310 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716314 12:11393474-11393496 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716419 12:11393843-11393865 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1093024231 12:14232222-14232244 CTGGCTCAGCCTGGGGAGGAGGG - Intergenic
1094249901 12:28347865-28347887 CTGGCTGATCTGGGGGAGAGGGG - Intronic
1096873975 12:54613018-54613040 CACCCTTACCTGGGAGAGGAGGG - Intergenic
1097240100 12:57569242-57569264 ATAGCTTTTCTGGGGGAGGAAGG - Exonic
1101807139 12:108073854-108073876 CTGGTTTACCTTGGGGAGGAAGG + Intergenic
1101852297 12:108413415-108413437 CTGGTTTAGATGGTGGAGGAAGG + Intergenic
1101906882 12:108833585-108833607 CTGGCTCACGGGGGTGAGGAGGG - Intronic
1102496208 12:113321009-113321031 CTGGCTTATCAATGGGAGGAGGG - Intronic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1105967290 13:25396436-25396458 ATGGCTAGCCTGGGGGATGATGG + Intronic
1106808856 13:33339219-33339241 CTGGTTTAACTGGTGGAGGCAGG + Intronic
1107115676 13:36742961-36742983 GAGGCCGACCTGGGGGAGGAAGG + Intergenic
1112061725 13:95747314-95747336 CTAACTTAACTGGGGGAGGAAGG + Intronic
1113444629 13:110355920-110355942 CTGGCTCACCTGTGGAATGAAGG + Intronic
1113925691 13:113940294-113940316 CTGGCTCATCTGGGGGTGGGGGG - Intergenic
1114279339 14:21176806-21176828 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114462028 14:22892607-22892629 CTGGCTGAGTTGGGGGAGGGAGG - Intergenic
1117054083 14:51892711-51892733 ATTGGTTACATGGGGGAGGAGGG - Intronic
1117457943 14:55916488-55916510 GTGGCTTACTTGAGGGAGAAGGG - Intergenic
1117539119 14:56729552-56729574 CTCGCTTACGGGGGGGTGGAGGG - Intronic
1118322295 14:64760228-64760250 CTGGCTTGGGTGGGGGAGGCAGG + Intronic
1120502989 14:85320276-85320298 CTGACTTAGCTGGGGAAGGTAGG - Intergenic
1121435829 14:93918799-93918821 ATGTCTTCCCTGAGGGAGGATGG - Intergenic
1121509655 14:94502880-94502902 CTGGGGTTCCTGGGGCAGGAAGG - Intronic
1121850580 14:97218570-97218592 CCTGGTTTCCTGGGGGAGGAGGG + Intergenic
1122172662 14:99889623-99889645 GTGGCTGACTTCGGGGAGGATGG + Intronic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122542015 14:102504017-102504039 CTGGCTGGCCTGGGTGAGGTGGG - Exonic
1122542117 14:102504495-102504517 CTGCCCTTCCTGGGGCAGGAGGG + Exonic
1123054290 14:105561867-105561889 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123071366 14:105644059-105644081 CTGGCTTACCTGGGCACGGTGGG + Intergenic
1123078874 14:105682286-105682308 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123091026 14:105742332-105742354 CTGGCTTACCTGGGCACGGTGGG + Intergenic
1123988902 15:25668644-25668666 CTGGCATTGGTGGGGGAGGAAGG - Intergenic
1124602860 15:31149312-31149334 CTGGCTTAGCTGAGGGGGGCGGG + Intronic
1126258644 15:46659188-46659210 TGGGCTTACCTTGGGGAGCAGGG - Intergenic
1126778667 15:52119971-52119993 CTGGCTCGCCTGGGAGAAGAGGG + Exonic
1127124884 15:55802277-55802299 CTGGCTGACAAGTGGGAGGAGGG - Intergenic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1127457212 15:59165934-59165956 CTGGCTGAACTGTGGCAGGATGG + Intronic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1128577927 15:68789085-68789107 CTGGCTGCTCTGGGGCAGGAAGG - Intronic
1129244830 15:74272758-74272780 CTGGCTGACCCTGGGGAGGCAGG - Exonic
1129330726 15:74826002-74826024 CTGGCTGAGCTGGGCCAGGAGGG - Intergenic
1130058918 15:80555563-80555585 CTGGCTGACTTGGAGGAGGTGGG + Intronic
1131144154 15:90000847-90000869 CTGGCTTCCCTTGGGGGGGGCGG + Intergenic
1131443571 15:92476969-92476991 CTGGTGTTTCTGGGGGAGGATGG + Intronic
1132236892 15:100228838-100228860 CCTGCCTACCTGTGGGAGGATGG + Intronic
1132545045 16:529032-529054 CTGGCCTGTCTGGGGGAGGCAGG + Intronic
1132710104 16:1262702-1262724 GTGTCCTTCCTGGGGGAGGACGG + Intergenic
1133076445 16:3284090-3284112 CTGGATCTCCTGGGGCAGGATGG - Exonic
1133822901 16:9252664-9252686 CCGATTTGCCTGGGGGAGGAGGG - Intergenic
1134513824 16:14870649-14870671 ATTGCTTCCCTGGGGAAGGATGG + Intronic
1134851856 16:17485335-17485357 CGGGCTTATCGGGGGGTGGAGGG - Intergenic
1134970364 16:18525501-18525523 ATTGCTTCCCTGGGGAAGGATGG - Intronic
1136063610 16:27743853-27743875 CTGGCTTTCCCGGGGCAGGTGGG - Intronic
1136186595 16:28592132-28592154 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136189216 16:28605925-28605947 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136317816 16:29464449-29464471 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1136432391 16:30203794-30203816 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138418338 16:56884232-56884254 ATGGCTACCCTGGGGGAGGAGGG - Intronic
1138445771 16:57062337-57062359 CTGTCTTATCTGGGGGACAATGG - Intronic
1138635727 16:58336772-58336794 CTGGGCTGCTTGGGGGAGGACGG - Intronic
1139351980 16:66342704-66342726 CTGCCTTTCCTGGGGGAGCACGG + Intergenic
1139450444 16:67024816-67024838 ATGGCTGAGCTGGGGGAGGGTGG + Intergenic
1139490920 16:67285523-67285545 CGGGCTTACATGGCGCAGGAAGG - Exonic
1139492936 16:67296483-67296505 CCAGCTTTCCTGAGGGAGGAGGG - Intronic
1139547399 16:67656136-67656158 CTTGCTCTCCTTGGGGAGGAAGG + Intronic
1139583157 16:67885016-67885038 CTGGCTTGGCTGGGCGAGAAGGG - Intronic
1140235191 16:73152785-73152807 CTGGGCTACCGGGGTGAGGAGGG + Intergenic
1140318347 16:73921821-73921843 CTGGCTTGACTGGGGCTGGATGG - Intergenic
1140380005 16:74478471-74478493 CCAGCATACCTGGGGCAGGAGGG + Intronic
1140847521 16:78904581-78904603 CAGGCTGACCTGGGGAAGGGAGG - Intronic
1141330056 16:83102638-83102660 CTGGCCACCCTGGGGGAGGGTGG + Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141525115 16:84606195-84606217 CTTGCTTAAGTGGGAGAGGAAGG + Intronic
1141548268 16:84786837-84786859 CTGCCATGCCTGGGGGAGGAGGG + Intergenic
1141660359 16:85438041-85438063 CAGGCTCATCTGGGGGAGGCGGG + Intergenic
1142260497 16:89040513-89040535 CTGGCTGGCCTGGGGGAGCAAGG + Intergenic
1142696565 17:1637054-1637076 CTCGCTGGCCTGAGGGAGGAGGG + Exonic
1142717090 17:1753067-1753089 CTGGCTTCCCTGGAAGGGGAAGG + Intronic
1142906837 17:3049179-3049201 CTGGGTTTTCTGGGGGTGGAGGG + Intergenic
1142954648 17:3513384-3513406 CTGGATATCCTGGGGGAGGAGGG - Exonic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145276626 17:21435257-21435279 CTGGCATACCTGGCAGTGGAAGG + Intergenic
1146272722 17:31494978-31495000 CTGGCCTGCCAAGGGGAGGATGG + Intronic
1147331757 17:39703396-39703418 CTCTCTTCCCAGGGGGAGGATGG - Intronic
1148067311 17:44881525-44881547 CTGGAGTAACTGGGGGAAGAAGG + Intronic
1148094090 17:45040490-45040512 CTGGCTTGGCTGGAGGCGGAAGG + Intronic
1148486830 17:47996163-47996185 CTTGCTTCCCTGGGGATGGAGGG + Intergenic
1148509202 17:48154432-48154454 GTGGCTTAGCTGGGGTGGGAAGG - Intronic
1148855996 17:50579641-50579663 CTGGCCTCCCTGGGGTAGCACGG + Intronic
1150455147 17:65301274-65301296 CTGGCTTCCCTGGAGGAAGCAGG + Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151363116 17:73600423-73600445 CTGCCTCCCCTGGGGGAGGCGGG + Intronic
1151805912 17:76405308-76405330 CTGACTGTCCTGGGGGAGGGAGG + Exonic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152001088 17:77645747-77645769 GTGGTTTAGATGGGGGAGGAGGG - Intergenic
1152110259 17:78353769-78353791 CTGGCCTGGCTGGGGGAGGAGGG - Intergenic
1152120178 17:78413679-78413701 CTGGGTGCCCTGTGGGAGGAAGG + Intronic
1152523172 17:80872415-80872437 CTGGCTTCCATGGGGGTGGGAGG - Intronic
1153041056 18:812773-812795 CTTGCTTTTGTGGGGGAGGACGG + Intergenic
1155989985 18:32270281-32270303 CTGGCTTGACTGTGCGAGGAGGG + Exonic
1156264176 18:35470907-35470929 CTGGCTTCCCTGTGGGAAGTTGG - Intronic
1156912667 18:42429035-42429057 CTAGATCACCAGGGGGAGGAAGG + Intergenic
1157179501 18:45483911-45483933 CTGGCATCAGTGGGGGAGGAGGG + Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1159387186 18:67741880-67741902 CTGTCTTGGCTGGGGGAGGGAGG - Intergenic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1160911529 19:1476112-1476134 CTTGCATACGTGGGGGAGCAGGG - Intronic
1160922644 19:1528224-1528246 CTGGGTTACCTGGGACAGGGCGG - Intronic
1160971556 19:1769968-1769990 CTGGCCTAGATGGGGGAGGGAGG - Intronic
1161006634 19:1940588-1940610 CTGGCTTTCCTGGGCGAGGAGGG - Intergenic
1161017078 19:1988341-1988363 CTGGCACTCCTGGGGGTGGATGG - Intronic
1161200975 19:3014606-3014628 GTCGCTTTCCTGGGGGAAGATGG + Exonic
1161764591 19:6199698-6199720 CAGGCTTACCGGGGGAAGAAAGG - Intergenic
1162132581 19:8536388-8536410 ATGGCATACCTGAGGGCGGAGGG + Exonic
1162431556 19:10631854-10631876 TTGGCTTTCCTGGGGGAAGGAGG - Exonic
1162565902 19:11445820-11445842 CTGGGTTACCTGGTGGAGGGTGG + Intronic
1162831267 19:13286244-13286266 CTGGCTCCCCTTGGGAAGGAAGG + Intronic
1162975317 19:14204931-14204953 CTGGCATGGCTGGGGGTGGATGG + Intronic
1163174096 19:15552177-15552199 CTGGCTGAGCTAGGGGTGGAGGG - Exonic
1163304545 19:16469706-16469728 CGGGCTAGCCTAGGGGAGGAGGG - Intronic
1163737462 19:18990260-18990282 CTGCCTGACCAGGGTGAGGAGGG - Intergenic
1164691332 19:30212940-30212962 AGGGCTTTCCTGGGGGAGAAAGG - Intergenic
1164770046 19:30801558-30801580 CTGGCTTAACCAGGGGAGAATGG + Intergenic
1165155554 19:33785027-33785049 CTGGATTACCTGGGGGTGAGGGG + Intergenic
1165278393 19:34774297-34774319 CTGGCTTCCCTGGGGGCTGGAGG - Intergenic
1166658136 19:44627222-44627244 CTGGCTTCCATGTGGTAGGAAGG + Intronic
1166812328 19:45522020-45522042 CTTGGTTCCCTAGGGGAGGAAGG + Intronic
1167112201 19:47469038-47469060 CTGGCTCCTCTGGGGGAGGGAGG + Intronic
1167305775 19:48708503-48708525 CTGGTTTTCCTGAGGCAGGAGGG + Intergenic
1167487243 19:49769832-49769854 CTGGCTTAACAGGGTGAGAAGGG + Intronic
1168677896 19:58292041-58292063 CTGGCTTGCAGTGGGGAGGAGGG + Intronic
925113128 2:1353194-1353216 CTGGCTGTCCTGGGGATGGAGGG - Intronic
925340106 2:3130315-3130337 CTGGCTTTGGTGGTGGAGGAAGG - Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926088696 2:10036245-10036267 CTGGCCTGTCTGGGGGAGGCTGG + Intergenic
926942381 2:18151978-18152000 CCTGCTTATCTGAGGGAGGAGGG + Intronic
929534645 2:42773417-42773439 CTGGCTGCACTGGGGGAGGTGGG + Intronic
929950580 2:46406755-46406777 CTTGCCCAGCTGGGGGAGGAAGG - Intergenic
932134248 2:69214546-69214568 TTAGCCTAGCTGGGGGAGGAAGG - Intronic
932792010 2:74662074-74662096 CTGGAGTCCCTGGGTGAGGAAGG + Intronic
935127851 2:100239854-100239876 CTCTCTTACCTGTGGGAGAAAGG - Intergenic
937461839 2:122095949-122095971 CTGCCTTACCTCCAGGAGGAAGG + Intergenic
937589272 2:123593889-123593911 CTGGGTCACCTAGGAGAGGAAGG + Intergenic
937743321 2:125381512-125381534 CAGGCTTGCCTGGGGAAGGATGG + Intergenic
937856079 2:126672786-126672808 CCACCTAACCTGGGGGAGGAAGG + Intronic
938161432 2:128987950-128987972 CTGGCCTACTTGGGGGATCAAGG + Intergenic
938406608 2:131036441-131036463 CTGGAAGACCTTGGGGAGGAGGG - Intronic
938874236 2:135516657-135516679 CTGGGTTACCTGGGTAACGAAGG - Intronic
938949033 2:136240415-136240437 TTGTCTTACCTGGGTGATGATGG + Intergenic
939001955 2:136747018-136747040 CTGGCCTTCACGGGGGAGGATGG - Intergenic
942320703 2:174733160-174733182 CTGGCTTAACTGGGGGCAGGAGG - Intergenic
942321340 2:174739170-174739192 CTGGCTGGCCAGGGAGAGGATGG - Intergenic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
945898233 2:215509099-215509121 CTTGCTTATCTGGGAAAGGAAGG - Intergenic
947310672 2:228798396-228798418 CTGGCTTATTTGGAGCAGGAAGG + Intergenic
947831136 2:233142612-233142634 CTGGCTGGCCTGGGGGATGGGGG + Intronic
948002579 2:234580402-234580424 CTTGTTTAACTGGAGGAGGATGG - Intergenic
948601046 2:239107677-239107699 CTGGCAGCCCTGGGGGAGCATGG + Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948912461 2:241011281-241011303 CTGGGTTTCCTGGGGGTGGCAGG + Intronic
1169756754 20:9051147-9051169 CTGGCTTTGGTGGTGGAGGAAGG + Intergenic
1170157915 20:13285407-13285429 CTGGCTTGGCTGGGGCTGGATGG + Intronic
1170822661 20:19767496-19767518 CTGGCTAGCCTCAGGGAGGATGG + Intergenic
1170870933 20:20205674-20205696 CTGTCTGACCTGGGCTAGGAAGG + Intronic
1171260035 20:23724062-23724084 CTGGGTTACCTGGGTGTGCAGGG + Intergenic
1171269106 20:23799595-23799617 CTGGGTTACCTGGGTGTGCAGGG + Intergenic
1171301238 20:24062523-24062545 CTGGATTATCTGGGGCTGGAGGG - Intergenic
1171412847 20:24958297-24958319 CTGGCCTACCCGGAGAAGGAGGG - Intronic
1172486406 20:35300597-35300619 CTGGCTGACCTGGGGGAGGGAGG + Intergenic
1172590152 20:36112138-36112160 CTGGCTTACAGGGTAGAGGATGG - Intronic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1174353477 20:49983652-49983674 TTGGGTGACCTGGGCGAGGAGGG + Intronic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174494441 20:50930366-50930388 CACCCTTACCTGGGGGAGGGGGG - Intronic
1174766148 20:53255688-53255710 CTGGCTGACCTTGTGGAGGCAGG - Exonic
1175326834 20:58135481-58135503 CTGGCTTACCTGAGGGGGCTTGG - Intergenic
1175856848 20:62125587-62125609 CTGGGCTCCCTGGGGGAGCATGG - Intronic
1176082739 20:63282144-63282166 GTGTCTTCCCTGGGAGAGGAAGG + Intronic
1176284481 21:5012301-5012323 TAGGCCTGCCTGGGGGAGGAGGG + Intergenic
1178624147 21:34201711-34201733 CCGGCTTAACTGGGGGATGAGGG + Intergenic
1179034473 21:37747688-37747710 CTGGCTTTGAGGGGGGAGGAGGG + Intronic
1179536666 21:42057251-42057273 GTGGCTTTCCTGGGGAAGGGCGG - Intergenic
1179872700 21:44251174-44251196 TAGGCCTGCCTGGGGGAGGAGGG - Intronic
1181107240 22:20582597-20582619 CTGGCTGACCTGGAAGTGGAGGG - Exonic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181529999 22:23511967-23511989 CTGGGTTTCCTGGGGAGGGATGG - Intergenic
1182661720 22:31929776-31929798 CTGGTCTACCAGCGGGAGGATGG - Intergenic
1182746022 22:32606076-32606098 CTGGCTGGCCTGGAGTAGGACGG + Intronic
1182787058 22:32916935-32916957 CTGTGTTGCCTGGGTGAGGAGGG + Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183479626 22:38056490-38056512 GTGGGTTCCCTGGGGGAGGTTGG - Intronic
1183787237 22:40036847-40036869 CTAGCTGACCTAGGGGAGGAAGG - Exonic
1184470203 22:44691877-44691899 CTGGCTTCCCTCGTGGAGGAGGG - Intronic
1184538377 22:45103165-45103187 CTGCCTGACCTGGGGGAAGCAGG - Intergenic
1184787377 22:46678405-46678427 CAGGCTTCCCTGGGGCAGGGCGG - Exonic
1184867716 22:47210710-47210732 CTGGCATTTCCGGGGGAGGAGGG + Intergenic
1185408432 22:50670911-50670933 CAGGCCCACCTGGGAGAGGAAGG + Intergenic
949894612 3:8759972-8759994 CTGTCTCACCTGGAGGAGGCGGG - Intronic
950263507 3:11558960-11558982 CTGACTTAGCCGGGGGAGGTGGG - Intronic
950502213 3:13371825-13371847 CTGGTTTACCTGGGAGTGGCTGG + Exonic
950936450 3:16844075-16844097 CTGGGATACCTTGGTGAGGACGG + Intronic
951162469 3:19441357-19441379 CTGGTTTTCCTGGGGTTGGAAGG - Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
953462244 3:43090735-43090757 CTGTCTTACCAGGGGGTGGAAGG + Intronic
953790010 3:45940193-45940215 CTGACATTCCTGGGGGAGGGGGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
959593708 3:108106077-108106099 ATGGCCTTCCTAGGGGAGGAGGG - Intergenic
960603638 3:119482502-119482524 CTAGTTTACCTGGGGGAAAATGG - Intronic
960673765 3:120175700-120175722 CTGGCTTAGAAGGTGGAGGAGGG + Intronic
961415411 3:126753133-126753155 CTGACTTTCTTGGGGGCGGATGG + Intronic
961819388 3:129567483-129567505 CGGGCTGACCTTGGGGAAGAAGG + Exonic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
963337789 3:143997120-143997142 GGGGCTTACCTGAGGGAGAAGGG - Intronic
963846138 3:150159834-150159856 CTGCCTTCCCTGGGGGTGGAAGG - Intergenic
964277864 3:155026728-155026750 CTTGCTTTTCTGGGGGAGGTGGG - Intronic
965748875 3:171956355-171956377 CTGGCTTTCCTTGGAGGGGAGGG - Intergenic
967048558 3:185760669-185760691 CTGCCTTACCTGGGGGTTGGAGG - Intronic
967221669 3:187252691-187252713 CTGGCTGACTTGGGGGATGGGGG + Intronic
967429375 3:189363905-189363927 CTGTCTTACTTGGGAGAGGTTGG - Intergenic
967863714 3:194173067-194173089 CTGACATTCCTGGGGGTGGAGGG + Intergenic
968356016 3:198108043-198108065 CTGGCCAAACTGGGGAAGGAGGG + Intergenic
968356079 3:198108295-198108317 CTGGCTAAACTGGGGAGGGAGGG + Intergenic
969150827 4:5167199-5167221 CTGCCTTACCTGGGGGCAGTTGG - Intronic
970224080 4:13839070-13839092 CTGGCTTAGAAGGCGGAGGAAGG - Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
970764415 4:19530440-19530462 CTGGCTTTCAAGGTGGAGGAAGG - Intergenic
972278874 4:37584539-37584561 GTGGTTTTCCTGGGGAAGGAGGG + Intronic
973209488 4:47599839-47599861 CTGGCTGCCCTGGGGAAGCAGGG - Intronic
973893148 4:55387856-55387878 TCGCCTAACCTGGGGGAGGATGG + Intergenic
974611949 4:64229091-64229113 CTAGCTTTTTTGGGGGAGGAAGG + Intergenic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
976224257 4:82782647-82782669 CTTGTTTTCTTGGGGGAGGATGG - Intronic
977710870 4:100123588-100123610 CTGTCTTACTTGAGGGAGGCAGG + Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981062771 4:140444373-140444395 GGGGCTTACTTGAGGGAGGATGG - Intronic
982086594 4:151842165-151842187 CTTGGGTACCTGAGGGAGGAGGG + Intergenic
985133795 4:186765499-186765521 CTGGCTTACATGGGGTGAGATGG - Intergenic
985213015 4:187615472-187615494 CTGGATTATCTGGGGGCAGAGGG + Intergenic
985470683 5:42504-42526 CAGGATTACCTGGGAGAGGGTGG + Intergenic
985522053 5:378547-378569 TTGGCTTCCCTGGGGAAGGCCGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987761953 5:22176475-22176497 CTGGCTTATTTAGGTGAGGAAGG - Intronic
988343101 5:30000493-30000515 CTAGCTTACCTAAGGGGGGAAGG + Intergenic
989173239 5:38494323-38494345 CTGGCTGACCAGGGGTAGGGTGG + Intronic
990982595 5:61615413-61615435 CTGCCTTACCAGGGGGCAGAGGG - Intergenic
991183443 5:63781106-63781128 CTAGCTTACCTGCTGGAGAATGG - Intergenic
991396255 5:66208204-66208226 CTCGCTCAGCTGGGGGAGGAGGG + Intergenic
991896743 5:71409938-71409960 CTGGCTTATTTAGGTGAGGAAGG - Intergenic
991962409 5:72058354-72058376 CTGGCTCATCTGGCTGAGGAGGG - Intergenic
997356845 5:133267859-133267881 CTGGCTTGGCTGGGGCAAGAAGG + Intronic
998604737 5:143622097-143622119 GGGGCTTACTTGGGGGTGGAGGG + Intergenic
999180131 5:149664316-149664338 CTGGCTGCTCTGGGAGAGGAAGG + Intergenic
999193640 5:149767163-149767185 CTGGCTTTGCTGGGAGAGGAAGG + Intronic
999275228 5:150325625-150325647 CTGCCTTAGCTGGGGCAGGGAGG - Intronic
999865415 5:155695420-155695442 GTGGCTTACATGGGAGTGGAGGG + Intergenic
1000026449 5:157363140-157363162 CTGGAGTGCCTTGGGGAGGAAGG - Intronic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1000826110 5:166046046-166046068 CTGGATTGCCTGGGGAATGACGG - Intergenic
1001548996 5:172588478-172588500 GGGGCTTAGCTGGGGGAGCAAGG + Intergenic
1002186882 5:177458739-177458761 CCGGCTCCCCTCGGGGAGGATGG + Intronic
1002644887 5:180648257-180648279 CTGGCTCAACCAGGGGAGGAGGG - Intronic
1002806214 6:576874-576896 CTGGGTTACCTGGGGAAGAAAGG + Exonic
1003108199 6:3231354-3231376 CTGGCTTCCCAGGCGGAGGAGGG - Intronic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005987582 6:30884267-30884289 GCGGGTTACCTGGGGGAGGCCGG + Intronic
1006169790 6:32086256-32086278 TTGGCTGACCTTTGGGAGGAGGG - Intronic
1006171816 6:32097441-32097463 CTGTCTGACCTGGAGTAGGAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006378472 6:33684584-33684606 CTGGTTGCCCTGGGGGAGGATGG - Exonic
1006383097 6:33712197-33712219 CTGGCTTATGAGGGGTAGGAAGG - Intergenic
1006919913 6:37620613-37620635 GTGGCTTGACTGGGGCAGGATGG + Intergenic
1007818143 6:44539292-44539314 CAGACTTTCCTGGGAGAGGAGGG - Intergenic
1008005133 6:46402435-46402457 CTGACTTGCCTTGGGGAAGAGGG - Intronic
1008385215 6:50881239-50881261 CTGGCCTATCTGGGGGAGGGGGG + Intergenic
1008885870 6:56431263-56431285 CTGGCTCCCCTGGTGGGGGAGGG - Intergenic
1009890382 6:69673556-69673578 GTGGGCAACCTGGGGGAGGAGGG + Intergenic
1010086063 6:71919353-71919375 GTGGCTAACCTGGGAGAGCATGG + Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1012974400 6:105764423-105764445 CTTGCTTCTCTGAGGGAGGAGGG + Intergenic
1013643086 6:112107234-112107256 CTGGCTTGCCTGAGGGTGCAGGG - Intergenic
1013778054 6:113700875-113700897 GTGTCTTACATGGGGGAGAATGG + Intergenic
1017287270 6:152690414-152690436 CTGGATTATCTGGGGCAGGAGGG - Intergenic
1017426850 6:154330949-154330971 CTGACATCCCTGGGGTAGGAAGG - Intronic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017769148 6:157631670-157631692 CTGGATTTCCTTGGAGAGGAAGG + Intronic
1018090911 6:160346973-160346995 ATGGCTAGCCTGGGGGAGAATGG + Intergenic
1019027818 6:168985927-168985949 CTTGATCACCTGGCGGAGGAGGG - Intergenic
1020139191 7:5603482-5603504 CTGGCATTCCTGGGGGATGGCGG - Exonic
1020393724 7:7689012-7689034 CTGCCTTACTCTGGGGAGGAGGG + Intronic
1021804008 7:24337020-24337042 GTGCTTTACTTGGGGGAGGAAGG + Intergenic
1021838786 7:24705925-24705947 TGGCCTTCCCTGGGGGAGGAGGG + Intronic
1021919706 7:25472491-25472513 CTTTCCTACATGGGGGAGGAGGG - Intergenic
1023017690 7:35983456-35983478 ATGGCTTACCTGGGGCTGGAGGG + Intergenic
1023090692 7:36614900-36614922 CTGGCTTACCTGGGGACCCATGG + Intronic
1023119694 7:36896902-36896924 CTGGCTTTCTTGTGGGAGGCTGG + Intronic
1024470934 7:49768412-49768434 GTGGCTGCCCTGGGGAAGGAGGG - Intergenic
1026899755 7:74030257-74030279 CTGGCTGTCCTGGGGGAGCCTGG + Intronic
1027125408 7:75553520-75553542 CTGGCCTCCCTGGAGGAAGAGGG - Exonic
1029269766 7:99370143-99370165 CTGGCCGACGTGGGGGAGGCAGG - Intronic
1029384022 7:100231899-100231921 AGGGCTTGCCTGGAGGAGGAGGG - Intronic
1029460738 7:100692857-100692879 CTGGCTAGCCTGGTGGAGGGTGG + Intergenic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1030077182 7:105746846-105746868 CTTGCTTATCTTTGGGAGGATGG + Intronic
1031242936 7:119269455-119269477 CTGGCATACCTGTGAGAGAAGGG - Intergenic
1032081925 7:128863494-128863516 CTGGCTTACCGGAGGCAGAAAGG - Intronic
1032720079 7:134543970-134543992 CTGGATTACCTGGGCCAGGCAGG - Intergenic
1034958198 7:155349019-155349041 CTGTCTGACCTGGTGGAGAATGG + Intergenic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1036787432 8:11697549-11697571 CAGGCTTCCCTGGCGGTGGAGGG - Intronic
1037320271 8:17634804-17634826 GGGGCCTACCTGGGGGTGGAGGG + Intronic
1038053412 8:23834791-23834813 GGGGCCTACCTGGGGGTGGAGGG - Intergenic
1038446109 8:27605394-27605416 CTGGCTCACCAGGGGGTGGGAGG - Intronic
1039159969 8:34606967-34606989 ATGACTTCCTTGGGGGAGGATGG + Intergenic
1039888866 8:41671233-41671255 TGGGCTTAACTGGGGCAGGACGG - Intronic
1040671147 8:49691834-49691856 ATGGCTTCCCTGGGGATGGAGGG + Intergenic
1045655031 8:104377730-104377752 CTGGCTACCTTGGGGAAGGAAGG + Intronic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1045702283 8:104880817-104880839 ATGGCTTACCTTTGGGGGGATGG + Intronic
1046171408 8:110512292-110512314 CTGGCTTCCCTGAGGGCTGAGGG + Intergenic
1046474586 8:114725256-114725278 CTGGCCTACTTGAGGGAGGAGGG + Intergenic
1046744698 8:117864370-117864392 TTGGCTTTCCTGGGCCAGGATGG + Intronic
1047346258 8:124031675-124031697 ATGGCTAACCTGGGGGTGAATGG + Intronic
1048443832 8:134478713-134478735 CTCGGTGACCTGCGGGAGGAGGG + Exonic
1048494105 8:134920922-134920944 AAGGTTTACCTTGGGGAGGAAGG + Intergenic
1048827220 8:138439959-138439981 CTGGCTTACCTGTGCAAGAATGG + Intronic
1049757896 8:144318912-144318934 ATGCCATACCTGGGGGTGGAGGG + Exonic
1052277356 9:26692220-26692242 TTGGCTTTCCTGGGGAAGAAAGG + Intergenic
1052576338 9:30296573-30296595 CTTACTTTTCTGGGGGAGGAGGG + Intergenic
1052832551 9:33228186-33228208 CTGGGTTACCTGGGTGAGCTTGG - Intronic
1053287438 9:36859153-36859175 CTGGCTTGCCGGGGGCAGGAAGG - Intronic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1055597476 9:77880320-77880342 CTGTCTTACCTGTGTGAGAAAGG - Intronic
1056145342 9:83723426-83723448 CTGGTTTACTTGGGAGATGAGGG - Intergenic
1056398401 9:86203229-86203251 ATGGCTAGCCTGGGGGAGAATGG - Intergenic
1056904350 9:90632381-90632403 TTTGATTACCTGGGGGAAGAGGG - Intronic
1057459719 9:95250174-95250196 CTGGCTTCCATGGGTGATGAAGG - Intronic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1059429271 9:114240421-114240443 CAGGCTTACCCTGGGGAGAAGGG - Exonic
1060236040 9:121863245-121863267 CTGGGTTCTGTGGGGGAGGATGG + Intronic
1060337086 9:122735300-122735322 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1060919011 9:127407311-127407333 CTGGCTCCCCTGGGGCAGGCAGG - Exonic
1061250371 9:129422912-129422934 CTGGGTTTCCTGGGGAGGGATGG + Intergenic
1061287821 9:129634192-129634214 AAGACCTACCTGGGGGAGGAGGG + Exonic
1062151940 9:135024142-135024164 GTGGCATTCCTGGGAGAGGAAGG + Intergenic
1203787136 EBV:134334-134356 CTGCATTGCCTGGGGGAGCAGGG - Intergenic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1186081983 X:5943171-5943193 CTGGCTTTGAAGGGGGAGGAAGG + Intronic
1186360418 X:8835747-8835769 CAGGCGAACATGGGGGAGGATGG - Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1186717040 X:12263272-12263294 CTGGTTTACCAGGGGGACTAAGG - Intronic
1187615348 X:20987767-20987789 TGGGCTTACCTGAGGGTGGAAGG + Intergenic
1189952368 X:46245775-46245797 CTTGTTTACCTGGGGCAGAAGGG - Intergenic
1190720531 X:53143836-53143858 CTGGCTTTGCTGGGGATGGATGG - Intergenic
1192207048 X:69103231-69103253 CTGGTGAACCTGGGGGAGAAGGG - Intergenic
1192496886 X:71622143-71622165 CTGCCTTAACTGGGGGTGGAGGG + Intergenic
1198083493 X:133261727-133261749 CTGGCTTTGAAGGGGGAGGACGG + Intergenic
1198851186 X:140966786-140966808 CTGGCTAGCCTTGGGGAGAATGG + Intergenic
1200732649 Y:6758880-6758902 ATGGCTTACCTTGGGTAGGGGGG + Intergenic