ID: 1127460161

View in Genome Browser
Species Human (GRCh38)
Location 15:59191279-59191301
Sequence GTGGATATTTAGTACAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122127
Summary {0: 1, 1: 1, 2: 53, 3: 4411, 4: 117661}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127460161 Original CRISPR GTGGATATTTAGTACAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr