ID: 1127464981

View in Genome Browser
Species Human (GRCh38)
Location 15:59235030-59235052
Sequence AAGCCTGCTCCCCAGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127464981 Original CRISPR AAGCCTGCTCCCCAGAGCCA TGG (reversed) Intronic
900031047 1:373527-373549 ATGCCTGCTTCCCAAGGCCATGG - Intergenic
900051620 1:601781-601803 ATGCCTGCTTCCCAAGGCCATGG - Intergenic
900333793 1:2150679-2150701 AGACCTGCTCCTCAGAGCCCAGG - Intronic
900547342 1:3236249-3236271 AAGCCTCCTTCCCAGCCCCAGGG - Intronic
900547684 1:3237612-3237634 GAGCCTGCTCCCGGGGGCCAGGG + Intronic
900582510 1:3416057-3416079 AAGCCTGACCCCCACAGCCTGGG + Intronic
900969756 1:5984900-5984922 AAGCCAGCTGCCCAGGGCGACGG - Intronic
901056701 1:6451683-6451705 AAGCCGACGCCCCAGAGCAAGGG + Exonic
901196888 1:7445332-7445354 AAGACTGCCCCACAGAGACAAGG + Intronic
901680398 1:10909681-10909703 AAGCCAGCTCCTGAGGGCCATGG + Intergenic
901858293 1:12058114-12058136 AAGCCTCCTACCCACAGCCGTGG + Intergenic
902032881 1:13435790-13435812 CTGTCAGCTCCCCAGAGCCAAGG - Intergenic
902368144 1:15990512-15990534 ACCCCTCCTCCCCAGGGCCAAGG + Intergenic
902532488 1:17099268-17099290 ATGCCTTCTCCCCAGAGGCTGGG - Intronic
902793200 1:18783115-18783137 CAGCCTGATCTCCAGTGCCAAGG - Intergenic
903003634 1:20283998-20284020 AAGACTGGTCCCCGAAGCCAGGG + Intergenic
903384257 1:22916382-22916404 AAACCTGCTTCCCAGAGCACAGG + Intergenic
903392278 1:22972872-22972894 AAGCCTGTGCCTCAGAGCCCAGG - Intergenic
903481077 1:23653772-23653794 ATGCCAGCTCCCCAGGGCTAGGG + Intergenic
903948566 1:26980151-26980173 CAGCCGCCTCCCCAGTGCCATGG + Intergenic
904465634 1:30705574-30705596 AAGCCTGGGTCCCAGTGCCAAGG + Intergenic
904604015 1:31689216-31689238 AGGCCAGCACCCCAGAGGCAGGG + Intronic
904832108 1:33311954-33311976 CACCCTGCTCCCCTGTGCCATGG - Intronic
905642052 1:39596782-39596804 AAGCCTGCGCCCCCTAGCCATGG + Intergenic
906215058 1:44033847-44033869 AGGCCAGCTGCTCAGAGCCAGGG - Intergenic
906383528 1:45347833-45347855 TAGCCTCCTCCCCAGAGGCCAGG - Intronic
906698633 1:47841691-47841713 AAGGCAGGTTCCCAGAGCCAGGG + Intronic
909931386 1:81503347-81503369 GGGTCTGCTCCCCAGAGCCTCGG + Intronic
910092755 1:83484633-83484655 ACGCCTGCTCACCACAGGCAAGG + Intergenic
910251298 1:85201271-85201293 GAGGCCGCCCCCCAGAGCCATGG - Intergenic
915487239 1:156230180-156230202 CAGCCTGATCCTCACAGCCAAGG + Intronic
917729761 1:177862875-177862897 AAGAATGCTCCCCAGAGACCAGG - Intergenic
919191891 1:194230883-194230905 CTGCCTGCTCCCTAGAGCAAAGG + Intergenic
919396978 1:197062864-197062886 AAGGCTGGTCTCCAGAGCCAAGG - Exonic
920181856 1:204137014-204137036 TAGCCTCCTACCCAGAGCCCAGG - Intronic
920279384 1:204831280-204831302 AAGCCAGCTCCCCAGAGAGCTGG + Intronic
920370119 1:205473394-205473416 AAGGCTTCTCCCCAGCTCCAGGG - Intergenic
920982714 1:210853380-210853402 AGGACTGCTCCCCAGAGGCTTGG + Intronic
921567884 1:216742108-216742130 AAGTCTGCTTCACAGAGCCTGGG + Intronic
921965507 1:221084052-221084074 AAACCTCGTCCCCAGAGCCTTGG - Intergenic
922801928 1:228368431-228368453 ACCCCTGCACCCCAGAGCCTGGG + Intronic
922802669 1:228371435-228371457 CCGCCTGCTCCCCGGGGCCAGGG - Exonic
922810047 1:228410306-228410328 AAGCCCCCTCTCCAGGGCCATGG + Intronic
922918849 1:229283516-229283538 AAGCCTGCTCTCTGTAGCCATGG - Intronic
922986391 1:229869157-229869179 ACTCCAGATCCCCAGAGCCATGG - Intergenic
923961815 1:239093526-239093548 AGGCCTGCTCTCCAGAGGAAGGG + Intergenic
924707895 1:246513198-246513220 ACCCCTTCTCCCCAGGGCCAAGG - Intergenic
924776000 1:247114760-247114782 CCGCCTGCTACCCAGAGCCCAGG - Intergenic
1062775996 10:148390-148412 AAGACTTCTTCCCAGAGCAAAGG - Intronic
1064639728 10:17403399-17403421 AGGCTTGCTTCCCACAGCCAAGG - Intronic
1067348261 10:45453894-45453916 AAGGCTGCTTTGCAGAGCCATGG - Intergenic
1069590812 10:69640795-69640817 AACCCTGCTCCCCGGGGACAGGG - Intergenic
1069717444 10:70530093-70530115 AAGCCAGGTCCCCAAAGCCAGGG + Intronic
1069851788 10:71409937-71409959 AGGCCTGCTGCTCAGAGCCCTGG - Intronic
1069932202 10:71890392-71890414 ATGCATGCTCCACTGAGCCATGG + Intergenic
1070108573 10:73460763-73460785 GACACTGCTCCCCACAGCCAGGG + Intronic
1071258141 10:83892981-83893003 AAGCCTGCTCCCCAGCCCCTAGG - Intergenic
1073293406 10:102424425-102424447 CTGCCTGCTCCCCAGAGCCTTGG - Intronic
1075726820 10:124614945-124614967 AATCCTGCTCCGGAGACCCATGG - Intronic
1076302461 10:129438412-129438434 ATGCCTGCATCCCACAGCCAAGG + Intergenic
1077167853 11:1151906-1151928 ATGTCTGCTCCACAGAGCCCTGG + Intergenic
1077321155 11:1942694-1942716 AAGCCACATTCCCAGAGCCATGG + Intergenic
1077432904 11:2524884-2524906 CTGCCTGCTCCCCAGGCCCACGG - Intronic
1077579501 11:3407766-3407788 ATCCCTGCTTCCCACAGCCAGGG + Intergenic
1078006939 11:7539350-7539372 AAGACAGCTCCTCAGAGCAATGG - Intronic
1078912383 11:15745088-15745110 ATGCCTGCTCTCCTGACCCATGG - Intergenic
1079986957 11:27209742-27209764 AAGCATTCTCCCCAGAGACTGGG - Intergenic
1080044657 11:27796663-27796685 AAGGCTGCCCCTCGGAGCCAGGG + Intergenic
1082660363 11:55902404-55902426 ATGCCTGTTCCCCAGAGTAAGGG + Intergenic
1083485671 11:62981669-62981691 AAGCCTTCTCCCCACAGCCTTGG + Intronic
1084236529 11:67791304-67791326 ATCCCTGCTTCCCACAGCCAGGG + Intergenic
1084485198 11:69444015-69444037 AAGCATTCTCCCCAGGACCAGGG - Intergenic
1084835895 11:71801689-71801711 ATCCCTGCTTCCCACAGCCAGGG - Intergenic
1085311781 11:75521118-75521140 CACCCTGCTCCCCATAGACATGG + Intronic
1085510694 11:77086663-77086685 AGCCCTCCTCCCCACAGCCAAGG - Intronic
1087174916 11:95087996-95088018 AAGGCAGCTACCCAGGGCCAGGG - Intergenic
1087789753 11:102393531-102393553 CACCCTGGGCCCCAGAGCCAAGG - Intergenic
1088626146 11:111732062-111732084 AGGCCTGCACCCCAAACCCAGGG + Intronic
1088814326 11:113410940-113410962 CAGGCTGGTCCCCAGAGCCGGGG + Intronic
1089311668 11:117562105-117562127 AAGCCTGCCCCTCTGAACCAAGG - Intronic
1090390807 11:126386138-126386160 TAGCCGGCTCCTCAGAGACATGG + Intronic
1090428750 11:126628766-126628788 CAGCCTGCTACCTGGAGCCAGGG + Intronic
1090887885 11:130895229-130895251 AATTCTGATTCCCAGAGCCATGG - Intronic
1092336870 12:7641041-7641063 AAGCATGGTCCCCCAAGCCATGG - Intergenic
1093506745 12:19875550-19875572 AAGTATGGTCCCCAGATCCATGG + Intergenic
1095318684 12:40798488-40798510 AAGGGTGTTCCCCAGAGCAATGG + Intronic
1095948491 12:47767320-47767342 AAGGCTGCCCCCTAGAGCCAGGG + Intronic
1096001290 12:48132830-48132852 AAGTCAGCTCCCCAGAGACAGGG - Intronic
1098535754 12:71592055-71592077 AAGCCTAATCCCCAGTGCAATGG + Intergenic
1098960986 12:76739487-76739509 AAGCCTCCTGGCCAGAACCAGGG - Intergenic
1100407735 12:94285774-94285796 AAGCCTGCCACCCAGACACAGGG - Intronic
1102483347 12:113239260-113239282 AATCCTGCTCCCCCCAGCTAGGG + Intronic
1103509513 12:121465030-121465052 AAGCCTGCCCCCCACTGCCCTGG + Intronic
1103908181 12:124337999-124338021 AACCCTGCTCCCCACAGCCAGGG + Intronic
1104940230 12:132391840-132391862 ATGCCTGGGCCCCAGAGCCTGGG - Intergenic
1107979729 13:45723158-45723180 AAAGCTGCTCCCTAGAGCTATGG + Intergenic
1108201129 13:48044535-48044557 AAGCAGGCTACCCAGATCCAAGG - Intronic
1110434495 13:75464172-75464194 GAGCCTGTTCCCAACAGCCAGGG - Intronic
1110561799 13:76917747-76917769 AAGCCTCCTGGCCAGAACCAGGG + Intergenic
1112000317 13:95203792-95203814 AATCCAGCTCCCCAGAGTTAAGG + Intronic
1112262802 13:97892973-97892995 AAGACTGCTTCCCAGAACCCGGG + Intergenic
1113094676 13:106651041-106651063 CAGCCCGCTCCCCATAGGCAGGG + Intergenic
1113327984 13:109301433-109301455 AATCCAGCTCCCCAGAGGCGGGG - Intergenic
1113472656 13:110557870-110557892 AGACCTGGTCCCCAGAGCCCTGG - Intronic
1114062851 14:19036905-19036927 ACTCTTGCTCCGCAGAGCCACGG - Intergenic
1114099408 14:19363092-19363114 ACTCTTGCTCCGCAGAGCCACGG + Intergenic
1114207447 14:20586102-20586124 AAGTCTGATCCCCTGAGCCCAGG + Intronic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118805721 14:69235099-69235121 AAGCCTTCTCCCCAGACCCCAGG - Intronic
1119072872 14:71605909-71605931 ATGCCTGCTTCCCAGGGCCCAGG - Intronic
1119392092 14:74297796-74297818 AATGCTGCTGCCCAGAGTCATGG - Intronic
1119413892 14:74456798-74456820 AATCCTGCCGCCGAGAGCCAAGG - Intergenic
1121122262 14:91383410-91383432 AGGCCTCCTCCCCAGCACCAAGG + Intronic
1122069689 14:99197580-99197602 AATCCTCCTCCCCACAGCAAGGG - Intronic
1122932200 14:104939144-104939166 ATGCTGGCTCCCCAGAGCCCCGG + Exonic
1123702090 15:22922332-22922354 AGGGCAGCTCCCCAGAGCCTTGG - Intronic
1124069748 15:26380257-26380279 AAGCCTGCTCACCTGCCCCAGGG + Intergenic
1124621365 15:31275884-31275906 TGGCCTGCTCCCTAGAGTCAGGG - Intergenic
1126111546 15:45178107-45178129 AAGCCTGTTCTGCAGAGCCCAGG + Intronic
1126209102 15:46079784-46079806 AATCAAGCTCCCCAAAGCCAGGG + Intergenic
1127464981 15:59235030-59235052 AAGCCTGCTCCCCAGAGCCATGG - Intronic
1127829505 15:62737948-62737970 CCACCTGCTCCCCAAAGCCAGGG - Intronic
1128872005 15:71166211-71166233 ACGCCAGCTGCCCAGAGCCTAGG - Intronic
1129295050 15:74595652-74595674 GGGTCTGCTCCCCAGAGCCTCGG + Exonic
1129688983 15:77702444-77702466 AAGCCTCCTCCCCAGGCCCCTGG - Intronic
1129692501 15:77721743-77721765 AAGCCTGGTCCCCAAGCCCAAGG - Intronic
1131054992 15:89369788-89369810 AGTTCTCCTCCCCAGAGCCAAGG - Intergenic
1132000065 15:98169656-98169678 AAGCCTGCTTCCTAGGGCCATGG - Intergenic
1132906188 16:2283981-2284003 AAGGGTCCTCCCCTGAGCCATGG + Intronic
1133222028 16:4322935-4322957 AGGCCGGGTCCCCAGAGCGAAGG - Intronic
1133304295 16:4800157-4800179 GGGCCTCATCCCCAGAGCCATGG + Intronic
1133348119 16:5083826-5083848 ATCCCTGCTTCCCACAGCCAGGG + Intronic
1133916489 16:10113415-10113437 CAGCCTCCTCCCCGGGGCCAGGG - Intronic
1135700802 16:24630867-24630889 GAGGCTGCTGCCCAGATCCAAGG + Intergenic
1136994885 16:35182609-35182631 CAGCCTGCCACCCAGAGCCCAGG + Intergenic
1137003655 16:35252286-35252308 CAGCCTGCCCCCCAGAGCCCAGG + Intergenic
1137461852 16:48671757-48671779 AAGCCTGAACCACAGAGTCAGGG + Intergenic
1137699754 16:50489055-50489077 CTGCCTGGTCCCCAAAGCCAGGG - Intergenic
1138081326 16:54093863-54093885 AAGCCTTCTTCCCAGAGCCAGGG + Intronic
1138530115 16:57630276-57630298 AAGTTGGCTCCCCAGAGCCCAGG + Intronic
1139065211 16:63304561-63304583 CAACCTGTTCCCCAGAGGCATGG - Intergenic
1139474426 16:67195669-67195691 AAGCCTGGTTCCCAGACCCAAGG - Intronic
1139678296 16:68539969-68539991 AATCCAGCTCCCCAAAGCCTGGG - Intronic
1141087961 16:81110302-81110324 AACCCAGTTCCCCAGAGCGAAGG - Intergenic
1141512940 16:84524449-84524471 AAGCCTGCTCACCAGGGCCATGG - Intronic
1141524032 16:84599862-84599884 CATCCTGCTGCCCAGAGCAAGGG + Intronic
1142592017 17:1010390-1010412 AAGCCAGCATCCCAGAACCAAGG - Intronic
1142961008 17:3552640-3552662 AAGCCTCCTCCGCCCAGCCAAGG - Intronic
1143530316 17:7499170-7499192 CAGCCTGCTTCCCTCAGCCAGGG - Intronic
1143858814 17:9872967-9872989 AGGCCGGCTCCCCAGGGCTACGG - Intronic
1144360122 17:14484197-14484219 AATCCTTATCCCCAGAGGCAAGG + Intergenic
1144772828 17:17769410-17769432 GAGCCAGCTCCCCCGAGGCACGG + Intronic
1145980968 17:29011376-29011398 AAGCCAGCTCCTAAAAGCCAAGG + Intronic
1145994030 17:29095499-29095521 AAGGCTGGTGCCCAGAGGCAGGG - Intronic
1146070630 17:29677775-29677797 AAGACTGCTTCCCAGAGTAATGG - Intronic
1146160991 17:30559471-30559493 ACCCCTCCTCCCCAGGGCCAAGG + Exonic
1147645171 17:42028928-42028950 CACCTTGCTCCCCAGAGCCTGGG - Exonic
1147949918 17:44101572-44101594 AAGGCAGCTCCTCAGATCCAGGG - Intronic
1148167795 17:45495703-45495725 AAGCCTGCTCCCCAGAAGGGTGG - Intergenic
1149311161 17:55395454-55395476 AAGGCTGCTGCCCAGTGCCCAGG - Intronic
1150398974 17:64842120-64842142 AAGCCTGCTCCCCAGAAGGGTGG - Intergenic
1152111013 17:78357859-78357881 AGCCCTTCTCCCCGGAGCCAGGG + Exonic
1152228619 17:79103824-79103846 TTGCCTGCACCCCAGAGCCCTGG - Intronic
1152628379 17:81398779-81398801 AGGCCGGCTCCTCAGAGCCCCGG - Intronic
1152804469 17:82348551-82348573 AAGACTGCCCCCCAGGGCCTGGG + Intergenic
1152948593 17:83212142-83212164 ATGCCTGCTTCCCAAGGCCATGG + Intergenic
1153053839 18:926238-926260 CAGCCTGATCCCAGGAGCCAGGG - Intergenic
1153435857 18:5067255-5067277 AAACCTGCTCCCAAAGGCCAAGG - Intergenic
1153757749 18:8301054-8301076 AAGTCTGCTTCCTAGAGCCTCGG + Intronic
1157595385 18:48860870-48860892 GGGCCTGCTCCCCAGGACCAGGG - Exonic
1157609074 18:48944791-48944813 TCGCCTGTTCCCCAGAGCCCAGG + Intronic
1157751158 18:50179689-50179711 CAGCCTGCTCTCTAAAGCCATGG + Intronic
1158720123 18:59917314-59917336 AAGCCCTCTCCCCAGGGCAATGG - Intergenic
1160549196 18:79682198-79682220 ACGGCAGCCCCCCAGAGCCAGGG - Intronic
1161102572 19:2428532-2428554 AAGCCTGCCCCGCTGAGCCCAGG - Exonic
1161466950 19:4436391-4436413 AAGCCGCCTCCACAGAGCCAGGG - Intronic
1161710176 19:5843383-5843405 AAGCCAGTTCCCCAGGGCCCAGG + Exonic
1162407790 19:10486102-10486124 AGGCCTCCAGCCCAGAGCCAGGG + Exonic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1166354246 19:42217558-42217580 CCGCCCGCTCCCCAGAGCCCAGG + Intronic
1166601134 19:44095304-44095326 AATACTTCTCCACAGAGCCACGG - Intronic
1167139592 19:47640552-47640574 AGGTCAGCTCCCCAGAGGCAGGG - Intronic
1167671541 19:50856411-50856433 ACACCTGCTCCCCAGACCCCAGG - Intronic
1167722840 19:51190662-51190684 AAGCATCCTCCCCCCAGCCATGG + Intergenic
925607996 2:5678648-5678670 CAATATGCTCCCCAGAGCCAGGG - Intergenic
926628054 2:15110531-15110553 CAGCCTGCTCGCCAGAGTGATGG + Intergenic
926689818 2:15725508-15725530 GAGCCTGCTGCCCAGACCCCAGG + Intronic
927718841 2:25370105-25370127 AATCCTGCCCTGCAGAGCCAGGG + Intergenic
927889564 2:26739857-26739879 CAGCCTCCTCCCCTGGGCCAGGG - Intergenic
928393000 2:30923595-30923617 AAGGATGCTGCCCAGAGACAGGG + Intronic
931758651 2:65396747-65396769 TGGCCGCCTCCCCAGAGCCAAGG + Intronic
931999183 2:67868204-67868226 AAGCCCGGTCCAAAGAGCCAGGG + Intergenic
932764773 2:74462621-74462643 AAACCTGCTCGCCAGAGCTCAGG + Exonic
935319351 2:101870769-101870791 CAGCGTGCTCTGCAGAGCCATGG - Intronic
935641410 2:105294081-105294103 CAGCCTGATGCCCAGAGGCATGG + Intronic
936145783 2:109979994-109980016 GCAGCTGCTCCCCAGAGCCAGGG - Intergenic
936198906 2:110391484-110391506 GCAGCTGCTCCCCAGAGCCAGGG + Intergenic
937194829 2:120144142-120144164 AAACCTAATCCCCAAAGCCATGG + Intronic
938480537 2:131658420-131658442 AACCCTGCCCCGCAGAGCCCTGG - Intergenic
938703664 2:133900995-133901017 AAGCTTGCACCCCTGATCCAAGG - Intergenic
939028135 2:137038753-137038775 TAGCCTGCTATGCAGAGCCAAGG - Intronic
941091248 2:161178897-161178919 TAGCCTTCTGCTCAGAGCCAAGG + Intronic
943369536 2:187001311-187001333 AAGCCTCCTTCCCAGGGCCAGGG + Intergenic
944117669 2:196206905-196206927 AAGTTTGCTCAGCAGAGCCAAGG + Intronic
944581514 2:201136961-201136983 CAGCCTCCTCCCCAGGGCCAGGG + Intronic
946280774 2:218664159-218664181 AAGCCAGAACCCCATAGCCAAGG - Exonic
946429012 2:219614766-219614788 AAGCCTGGGCCCGAGAGCAAAGG - Intronic
947201536 2:227618738-227618760 AAGGCTGGTCCCCAGAGGCCCGG - Intronic
947626405 2:231621773-231621795 GAGCCTTCTCCCCAGAGCTGGGG + Intergenic
947813026 2:233016079-233016101 AACCCAGCTCCCCAGGCCCAGGG + Intergenic
947909991 2:233794523-233794545 AAGCCTCCTGCCCAGAGCCGTGG - Intronic
1168956959 20:1841156-1841178 CATCCTGCTCCCCCGACCCAAGG + Intergenic
1170876482 20:20254426-20254448 CAGCCAGCTGCCCAGAGCCTCGG + Intronic
1171417790 20:24995139-24995161 GAGCCTCATCCCCAGTGCCAGGG - Intergenic
1171544918 20:25992459-25992481 AGGCCTCCACCCCCGAGCCAAGG + Intergenic
1174039474 20:47688746-47688768 AAGCCTCCTCCCCAGAGATCAGG + Intronic
1175218886 20:57405744-57405766 GAGCTCCCTCCCCAGAGCCAGGG - Intronic
1175218901 20:57405794-57405816 GAGCTCCCTCCCCAGAGCCAGGG - Intronic
1175681189 20:60990015-60990037 CAGCCTGCTCCCCAAAGGGAAGG - Intergenic
1175948105 20:62568081-62568103 AAGGCTACTCCCCAGGGTCAAGG + Intronic
1176041676 20:63068941-63068963 AGTCCAGCTCCCCAGAGCCGGGG - Intergenic
1176105926 20:63386628-63386650 CATCCTGTTCCCCAGGGCCAGGG - Intergenic
1176247320 20:64103605-64103627 AGGCCTCCTGCCCATAGCCATGG + Intergenic
1178986149 21:37304854-37304876 AAGCCTGATCTCCAGTGCGATGG + Intergenic
1179043878 21:37828640-37828662 CAGCCTGCCACGCAGAGCCATGG - Intronic
1180481345 22:15759532-15759554 ACTCTTGCTCCGCAGAGCCACGG - Intergenic
1180481681 22:15760887-15760909 AACCCTGCCCCGCAGAGCCCTGG - Intergenic
1180835173 22:18926137-18926159 AGGCCTCCACCCCAGAGCCAGGG + Intronic
1181483233 22:23214438-23214460 AAGCCAGGTCCTCAGAGCCCAGG - Intronic
1181711728 22:24695650-24695672 AGGCCTCTGCCCCAGAGCCAGGG + Intergenic
1181885886 22:26022158-26022180 GTGCCTGCTTCCCAGAGCCTGGG - Intronic
1182265137 22:29108697-29108719 ATGCCTGCTCCTAAGACCCATGG - Intronic
1183082471 22:35465330-35465352 AAGCCTGCTCCCCAGCTGCCTGG + Intergenic
1184792622 22:46709249-46709271 ACGCCTTCTCCCCAAACCCAGGG - Intronic
1184926279 22:47642057-47642079 AAGCCTGCTCGCTCTAGCCAAGG + Intergenic
1185048328 22:48540275-48540297 AAGCCTGCTCCCCAGGACCAGGG + Intronic
1185054951 22:48574814-48574836 AACCCCGCTCCCCAGAGCAGGGG - Intronic
1185252849 22:49814454-49814476 AAGCCTGCTGCCCATCGCCAGGG + Intronic
1203285261 22_KI270734v1_random:151436-151458 AGGCCTCCACCCCAGAGCCAGGG + Intergenic
949626727 3:5875575-5875597 CTGCCTGCACCACAGAGCCAAGG + Intergenic
950105328 3:10384901-10384923 AGGCCTTCTTCCCAAAGCCAGGG + Intronic
950177620 3:10886306-10886328 AAGACTGCTCCCCGTGGCCATGG + Intronic
950259562 3:11534489-11534511 AGGACACCTCCCCAGAGCCAAGG + Intronic
950441720 3:13014584-13014606 TTGCCTGCCCCCAAGAGCCAGGG + Intronic
950831637 3:15880098-15880120 CAGCCTCCTCCCCAGGGCCAGGG - Intergenic
951209701 3:19961958-19961980 AAGCCCACTCACCAGAACCATGG - Intronic
953795495 3:45982688-45982710 AACCCTGCTCCCAAGAACCATGG + Intronic
954036775 3:47855000-47855022 AACCTTGCTCCTGAGAGCCATGG - Intronic
954274847 3:49535427-49535449 CAGCCTGCTCCCCTGAGCGCTGG + Exonic
954644498 3:52122632-52122654 AAGCCTGCTCCCCAGGGAGGTGG - Intronic
954714478 3:52520289-52520311 AAGCCCTCTCCCCAGACTCACGG - Exonic
957052474 3:75421088-75421110 ATCCCTGCTTCCCACAGCCAGGG + Intergenic
958675538 3:97264865-97264887 AACCCTCCTCTCCATAGCCAGGG - Intronic
960017003 3:112902592-112902614 AAGCCCTCACCCCCGAGCCAAGG - Intergenic
960313455 3:116146126-116146148 AAGCCTGCTCCCTAGAAGAAGGG - Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
961302374 3:125930466-125930488 ATCCCTGCTTCCCACAGCCAGGG - Intronic
962738755 3:138348292-138348314 AAGCCAGCTCCCCGGCACCACGG + Exonic
963973700 3:151457556-151457578 AAGCCTGGCCTCCAGAGCCCAGG - Intronic
965665429 3:171088666-171088688 GAGACTGCTCTCCAGAGCAATGG - Intronic
965894145 3:173553277-173553299 AAGCCTGATCCCAAGACCTAAGG + Intronic
968620844 4:1602866-1602888 AAGCCGGCCCACCAGGGCCATGG + Intergenic
968656435 4:1780284-1780306 CAGCCTCCTCCCCAAATCCATGG + Intergenic
969254466 4:5992823-5992845 AAGCGAGCTCCCCAGAGACCTGG - Intergenic
969758710 4:9167330-9167352 ATCCCTGCTTCCCACAGCCAGGG - Intergenic
969835085 4:9833929-9833951 AAGCCTTCTGCACAGAGCAAGGG - Intronic
972173409 4:36375221-36375243 AAGCCTCCTCCCTGGGGCCATGG + Intergenic
972585447 4:40433345-40433367 ATGCCTGCTCCCTAGAGGAAGGG + Intronic
973584295 4:52375536-52375558 AAGACTGATCCCCAGAGACTTGG + Intergenic
973792965 4:54395164-54395186 AGGCCTGTGCCTCAGAGCCATGG + Intergenic
974664152 4:64936334-64936356 AAGCCTGGTCCCCAGTGAAATGG - Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
976208144 4:82641304-82641326 ACCCCTGCTCCACAAAGCCAGGG - Intronic
976659282 4:87522504-87522526 CAGCCAGCTCCCGAGAGCAAGGG - Intronic
976755951 4:88498125-88498147 AAGGATACTCCACAGAGCCATGG + Intronic
985576804 5:677401-677423 AATGCTGCTCCCCGGAGTCAGGG - Intronic
985747503 5:1655445-1655467 AATGCTGCTCCTCACAGCCACGG - Intergenic
985789034 5:1915557-1915579 AGGGCTGCTCCCCAGACGCAGGG - Intergenic
985898632 5:2767213-2767235 ACACCTGCACCCCAGAGCCCCGG + Intergenic
986337655 5:6767098-6767120 AAGCCAGCTCCCAGGACCCATGG - Intergenic
986453015 5:7885058-7885080 GAGGCTCCTCCCCAGAGCCCTGG + Intronic
987061783 5:14250343-14250365 ATGCCTGCTCCCCCTGGCCAGGG + Intronic
988930309 5:36030573-36030595 AACACTGCTCTCCAGTGCCAGGG + Intergenic
991218952 5:64190106-64190128 AAGGCTGCCACCCAGAGCCAAGG + Intronic
991918005 5:71624241-71624263 AGCCCTGCTCCCCAGAGTGATGG - Intronic
998509228 5:142697629-142697651 AAGAAAGCACCCCAGAGCCAAGG - Exonic
1001408110 5:171490471-171490493 AAGGCTGCTCCCCAGATCTACGG - Intergenic
1002345312 5:178544440-178544462 GAGACTGCTCCCCACCGCCATGG - Intronic
1002434382 5:179221885-179221907 AGGCCTGCTCCTCAGCCCCATGG - Intronic
1002565360 5:180110114-180110136 GAACCTGCTCCCCAGGGCCCCGG - Intronic
1002742773 5:181445341-181445363 ATGCCTGCTTCCCAAGGCCATGG + Intergenic
1002800383 6:516497-516519 AGGCCTGCCCTGCAGAGCCAGGG - Intronic
1003491045 6:6621814-6621836 AAGCTAACTCCCCAGTGCCAGGG - Intronic
1003834603 6:10057565-10057587 AAGCCTCCAGCCAAGAGCCAAGG + Intronic
1004731735 6:18366182-18366204 TAGCCTCCTCCCCAGGGCCTGGG + Intergenic
1007637045 6:43305904-43305926 AACCCTGCACCACAGACCCAGGG - Intronic
1010216063 6:73402958-73402980 CTGCCTCCTCCCGAGAGCCAAGG - Intronic
1011249231 6:85353462-85353484 AAGCCTGCCCTGCAGAGCAAAGG + Intergenic
1013654220 6:112228630-112228652 AAGCCTGTTACACAAAGCCAGGG + Intronic
1014884425 6:126762166-126762188 CAGCCTGCTTTCCTGAGCCACGG - Intergenic
1018081850 6:160265978-160266000 AACCATGTTTCCCAGAGCCATGG - Intronic
1018469856 6:164085631-164085653 AAGCCGGCTCTCCAGGGCCGCGG + Intergenic
1019247904 6:170721080-170721102 ATGCCTGCTTCCCAAGGCCATGG + Intergenic
1022629107 7:32068998-32069020 AAGCCTGCCAGCCAGAGACAAGG + Intronic
1023624082 7:42099029-42099051 CTGCCTGCTCCCCCGTGCCAAGG + Intronic
1023993384 7:45144185-45144207 AATCCTGCTCACAAGAGCCCAGG - Intergenic
1024183906 7:46928264-46928286 CTGCCTGCTCCCCTGAGCCCTGG + Intergenic
1024242939 7:47449324-47449346 CAGCCTGGTCCTCAGAGCCCTGG + Intronic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1024264117 7:47593671-47593693 CAGCTTGCTCTCCGGAGCCAAGG - Intergenic
1025296321 7:57777524-57777546 AGGCCTCCACCCCCGAGCCAAGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1026465063 7:70646787-70646809 AGCCCTGCTGCCCTGAGCCAGGG - Intronic
1026792103 7:73340763-73340785 AAGCCTGCTCTCCATAGCACAGG - Exonic
1027025600 7:74849942-74849964 ACGTCTGCTCCCCAGGGCCCTGG - Intronic
1027062164 7:75094177-75094199 ACGTCTGCTCCCCAGGGCCCTGG + Intronic
1027309615 7:76941129-76941151 ACGCCTGCTCACCACAGGCAAGG + Intergenic
1029526953 7:101100561-101100583 ACGTCTGCTCCCCACAGCCTTGG + Intergenic
1030701661 7:112647308-112647330 AAGCCCACACCCCACAGCCAAGG - Intergenic
1031901696 7:127418149-127418171 AAGCCAGATCCCCAATGCCAGGG + Intronic
1032414434 7:131725488-131725510 CAGCCTCCTCCCCTGAGCCAGGG - Intergenic
1033097390 7:138442755-138442777 AAGCCTCCTCCCCAGGGACAGGG - Intergenic
1033879325 7:145862170-145862192 GAGCCTTCTCCCCCGAGCCAAGG + Intergenic
1034468043 7:151241451-151241473 CCGCCTGCTCCCCAGATCCCAGG + Intronic
1034471015 7:151254340-151254362 AAGGCTGCCCCCCAGATCCCTGG - Intronic
1035481864 7:159193166-159193188 CAGCCTGCTGCCCAGATCCCAGG - Intergenic
1035500209 8:86784-86806 ATGCCTGCTTCCCAAGGCCATGG - Intergenic
1035971537 8:4254799-4254821 CAGGCTGCACCCCAGAGCCTAGG + Intronic
1036489034 8:9207382-9207404 AAGCCTCCTCCACATAGCCATGG - Intergenic
1036827825 8:11992248-11992270 AAAGCTGATCCCCAAAGCCAGGG - Intergenic
1036847801 8:12181634-12181656 ATCCCTGCTTCCCACAGCCAGGG + Intergenic
1036869169 8:12423949-12423971 ATCCCTGCTTCCCACAGCCAGGG + Intergenic
1037578952 8:20233471-20233493 ATGCCTTCTCTTCAGAGCCACGG + Intergenic
1037987154 8:23297128-23297150 AAGCCTGCTGCTCAGGGCCCAGG + Intergenic
1038382784 8:27112683-27112705 CAGCCTCCTCCCCAGAGCCCAGG - Intergenic
1039123504 8:34175323-34175345 AAGCCTGCTGGCCAGAGCTTGGG + Intergenic
1040592195 8:48803820-48803842 AAGCCTGGTCCCCCGCTCCAGGG - Intergenic
1040933245 8:52756800-52756822 ATGCCTGCTGCCCAGGTCCAAGG + Intergenic
1041845928 8:62329067-62329089 AAGCCTTCTGCCAACAGCCATGG + Intronic
1042141363 8:65681781-65681803 AGGCCTGCTCCCCAAAGGAAAGG - Intronic
1046003344 8:108447797-108447819 AAGCTCGCTCCTCAAAGCCAAGG - Intronic
1047029610 8:120862195-120862217 AAACCTGATGCCCAGAACCAAGG - Intergenic
1047275640 8:123402623-123402645 CAGCCTTCTCCCCAGGGCCAGGG - Intronic
1048915116 8:139175280-139175302 ATGTCTTCTCTCCAGAGCCATGG + Intergenic
1049254263 8:141605417-141605439 CAGCCTGCTCCCCAGCCCCGAGG - Intergenic
1049861320 8:144901223-144901245 CGGCCTCCTCCCCAGGGCCAAGG - Intronic
1050528548 9:6566971-6566993 CAGCCTGCCTCCCAGAGCTACGG + Intronic
1050619214 9:7435014-7435036 AAGGATGCACCCCAGAGACAAGG - Intergenic
1052781441 9:32784541-32784563 AAGCCTCCCCCACAAAGCCAGGG + Exonic
1052941050 9:34132628-34132650 CAGCCTCCTCCCCAGGGCCAGGG + Intergenic
1053458628 9:38251196-38251218 AAGCCTCCTGTCCAGAGTCATGG + Intergenic
1053466341 9:38311436-38311458 AAGGCTGCTCACAGGAGCCAGGG - Intergenic
1055139904 9:72864580-72864602 GAGACTGTTCCCCAGGGCCATGG - Intergenic
1055801462 9:80040897-80040919 AGGTCTGCTCCCCAAAACCAAGG - Intergenic
1056909227 9:90682969-90682991 AGGCCTGAGCCCCAGGGCCATGG + Intergenic
1057257774 9:93564358-93564380 AAGCCGGCTCCCCAGATGAACGG + Exonic
1057354694 9:94323553-94323575 GAGAGTGCTCCCCAAAGCCACGG - Intronic
1057634215 9:96748097-96748119 TAGCATGCTCCACAGGGCCATGG + Intergenic
1057653064 9:96934082-96934104 GAGAGTGCTCCCCAAAGCCACGG + Intronic
1058160425 9:101564472-101564494 AAGCCAGCTGCCCAGCACCAGGG + Intergenic
1058254321 9:102742563-102742585 AAGCTTCCTGCCCAGAGGCAAGG - Intergenic
1058879593 9:109274970-109274992 AAGCTTGCTTCTGAGAGCCAAGG - Intronic
1059301598 9:113317980-113318002 AACCCAGCTCCCCAGAGTCCTGG - Intronic
1059409558 9:114123585-114123607 CAGCCTGGCCCACAGAGCCAGGG - Intergenic
1059460659 9:114427665-114427687 AACCCTGCTCCCCAGTTCCCCGG + Intronic
1060757939 9:126226313-126226335 AACTCTGCTGCCCAGAGCCCCGG - Intergenic
1060813525 9:126623240-126623262 GAGGCTGCTCCTCGGAGCCAAGG + Intronic
1061213325 9:129206093-129206115 AAACCTGCGCCCCAGAATCAGGG + Intergenic
1061906840 9:133703345-133703367 AGGGCTGCTCCCTGGAGCCACGG + Intronic
1062031883 9:134365521-134365543 CAGCCTGGTCCACACAGCCATGG - Intronic
1062062265 9:134502838-134502860 AAGCCTGCTCCCCAGCCACGTGG - Intergenic
1062296083 9:135827953-135827975 AAGCCTTCTCCCAGGAGCCTGGG - Intronic
1062391410 9:136335389-136335411 AAGCGTGCTCCCGTGAGGCACGG - Intronic
1203608676 Un_KI270748v1:76559-76581 ATGCCTGCTTCCCAAGGCCATGG + Intergenic
1186174001 X:6906123-6906145 CACCTTGCCCCCCAGAGCCATGG - Intergenic
1186643547 X:11482582-11482604 AAGTCTGCACCCCAGAGCCACGG - Intronic
1187440962 X:19319289-19319311 GAGCCTGCTCCACAGAGTCTTGG - Intergenic
1187669604 X:21656273-21656295 AAACCTGCTCCTCAGGGCCCAGG + Exonic
1189571791 X:42306382-42306404 AAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1189658876 X:43277545-43277567 CAGCCTCCTCCCCAAGGCCAGGG + Intergenic
1193780870 X:85699401-85699423 AAGCTTCCTCCCCCTAGCCAAGG - Intergenic
1197082991 X:122441063-122441085 TGGCCTGATGCCCAGAGCCATGG + Intergenic
1199535336 X:148896171-148896193 ACACCTGCTCCCCTGAGCTAAGG - Intronic
1200064683 X:153498686-153498708 CGGCCTGCCCCCCAGAGCCTGGG - Intronic
1200122513 X:153797843-153797865 CATCCTGCTCCCCAGGGACAGGG - Intronic
1200163575 X:154021077-154021099 GAGGCTGCTCCTGAGAGCCAAGG + Intergenic
1200826680 Y:7651849-7651871 AACCCTGCTTCCCAGAGACCAGG + Intergenic