ID: 1127474076

View in Genome Browser
Species Human (GRCh38)
Location 15:59315772-59315794
Sequence CAGCAACAGCAGCAGCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 16, 3: 121, 4: 685}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127474076_1127474079 19 Left 1127474076 15:59315772-59315794 CCCCAATGCTGCTGCTGTTGCTG 0: 1
1: 1
2: 16
3: 121
4: 685
Right 1127474079 15:59315814-59315836 AAGCACACTTAGATTAAGATTGG 0: 1
1: 0
2: 1
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127474076 Original CRISPR CAGCAACAGCAGCAGCATTG GGG (reversed) Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900754073 1:4421466-4421488 CAACAAAAGCAGCAACCTTGGGG - Intergenic
901084524 1:6602545-6602567 CAGCAGCAGCTGCAGCATGTCGG + Exonic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902489361 1:16769808-16769830 CAGCAGGAGCAGCAGCTTTTGGG - Intronic
902581759 1:17412175-17412197 CAGGAAGAGCAGCATCATTGTGG - Exonic
902609949 1:17591179-17591201 CAGCACCATCAGCACCAGTGAGG - Intronic
903057384 1:20645616-20645638 CAGCTGCAGCAGCATCATGGCGG - Exonic
903057385 1:20645619-20645641 CAGCAGCTGCAGCAGCATCATGG - Exonic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903372275 1:22844381-22844403 CAGAGACAGCAGCAGCACTCTGG - Intronic
904439838 1:30523064-30523086 CAGGAACAGCAGGAGAATTTGGG - Intergenic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905318645 1:37099776-37099798 CCGCAAAAGAGGCAGCATTGTGG - Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905656584 1:39689902-39689924 CAGCAATAGCAGCAGCAACCAGG + Intronic
905776394 1:40670042-40670064 CACCAACAGCAGCTGAATTCAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906296970 1:44654874-44654896 CAGCAACAGGCGCAGCATGGCGG + Exonic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907047961 1:51311538-51311560 CAGCAACATCAGATGCACTGTGG + Intronic
907146354 1:52236194-52236216 TAGTAAAAGCAGCAGGATTGAGG - Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907916539 1:58874989-58875011 CTGCAACAACAGCAGCCTGGTGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
913202512 1:116506689-116506711 CAGCAAGAGCAGGAGCATGTCGG - Intergenic
913997438 1:143662817-143662839 CAGCTACAGCATCAGCATCAAGG - Intergenic
914513704 1:148355486-148355508 CAGCAACAACAGCAGTGTTCTGG - Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915368120 1:155326649-155326671 CAGCAGGAGCAGCAGCTCTGTGG - Exonic
915837909 1:159192627-159192649 CAGCATCAGCATCAGCAATGTGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916875373 1:168963182-168963204 CAGCAACATCAACAACATTTGGG - Intergenic
917522600 1:175760560-175760582 CAGTGACAGGAGCATCATTGCGG - Intergenic
917742607 1:177975682-177975704 CAGCAACATCTGATGCATTGTGG + Intronic
918013653 1:180611224-180611246 CAGCAACAGCAGCAAATATGTGG + Intergenic
918589947 1:186229965-186229987 CCTCTAAAGCAGCAGCATTGAGG - Intergenic
918793817 1:188865763-188865785 CAGCACCAGGTGCAGCTTTGTGG - Intergenic
919398949 1:197084753-197084775 CAGCAACAGCAACATCTATGTGG + Intronic
919444788 1:197689481-197689503 CAGCACCAGCAGCAACAGTAAGG - Intronic
919653540 1:200175028-200175050 CAGCAACAGTAGCAGAAATAAGG - Exonic
919790670 1:201288827-201288849 CTGAAAGAGCAGCAGGATTGTGG + Intronic
919871445 1:201824793-201824815 CAGCAGCATCAGCAGCCTTTGGG + Exonic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920619001 1:207525465-207525487 CAGCAATATCAGCTGCATTCTGG - Intronic
920620782 1:207544021-207544043 CAGCAATATCAGCTGCATTCTGG - Intronic
920622564 1:207562578-207562600 CAGCAATATCAGCTGCATTCTGG - Intronic
920635289 1:207696218-207696240 CAGCAATATCAGCTGCATTCTGG - Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921104270 1:211959964-211959986 CAGCAGCAACAGCAGCATAACGG - Intronic
921263747 1:213405656-213405678 CAGCAGTAGCAGCAGCAATCTGG + Intergenic
921446160 1:215249553-215249575 CAGCTAAAGCACCAGCTTTGGGG - Intergenic
921590293 1:216994916-216994938 CAGCAAGAGCAGGATCACTGAGG - Intronic
921739257 1:218665365-218665387 CAGCAACAGCAGCTGAGCTGTGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922030698 1:221794724-221794746 CAGCAACAGGAGCTGAACTGGGG - Intergenic
922807884 1:228400032-228400054 CAGCCACATCTGCAGCATTGTGG + Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923531077 1:234812717-234812739 CAGCAGGAGCAGCAGCTTTTGGG + Intergenic
923596053 1:235361506-235361528 CACCACCAGCAGCAACACTGTGG + Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924335176 1:242980377-242980399 CAGGAACAGCCTCAGCATAGGGG + Intergenic
924370984 1:243349385-243349407 CTGCAACAACAGCAGAGTTGAGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924586741 1:245367163-245367185 CAGCAAACCCAGCAGCCTTGGGG + Exonic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1063112954 10:3052749-3052771 CAGGCACAGCAGCAGCATCAAGG - Intergenic
1063435645 10:6027482-6027504 AGGCAAGAGCAGCAGCATGGTGG + Intronic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1064443096 10:15371020-15371042 CAGGCACAGCAGCAGCGTCGCGG + Exonic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065447391 10:25817338-25817360 CAGTTACAGGAGCTGCATTGGGG + Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066313676 10:34222516-34222538 CAGCAACAGCAGAAGCTTTCTGG + Intronic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068613068 10:59082088-59082110 CAGCATCAGCAGCACCACTTGGG + Intergenic
1068657594 10:59591347-59591369 CAGCAGCAGCAGCAGCCATATGG - Intergenic
1068741139 10:60472707-60472729 CAGCAACCGCACAAGCATTAAGG + Intronic
1069351052 10:67527950-67527972 CAGAATGAGCAGGAGCATTGTGG - Intronic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069916563 10:71790397-71790419 CATCAACAGCAGCACCGGTGAGG + Intronic
1070512140 10:77171132-77171154 CAGCAGCAGCAGCATCACTTGGG + Intronic
1070578435 10:77698512-77698534 GAGCAGAAGCAGCAGCAATGGGG + Intergenic
1070817912 10:79336693-79336715 CAGCCACAGGAGCAGCACAGGGG + Intergenic
1070938883 10:80325297-80325319 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
1071166013 10:82807591-82807613 CAGCAACATCAGCATCATCTGGG + Intronic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071675549 10:87652410-87652432 CAGCAACATCAGCAGCCCTTGGG + Intergenic
1071882107 10:89910897-89910919 CAGCAGCAGTGGCAGCATGGTGG + Intergenic
1072270741 10:93773983-93774005 CAACAGCAGCAGCATCATGGAGG - Intronic
1072436557 10:95419293-95419315 CAGCAACAGCAAAAGCTTTCAGG + Intronic
1073104238 10:101023192-101023214 CAGCAGGAGCAGCGGCAATGTGG + Intronic
1073127369 10:101159727-101159749 TAGCAACAGGTGCAGCATGGGGG - Intergenic
1075818107 10:125281969-125281991 AAGCAGCAGCAACAGCCTTGTGG - Intergenic
1076129089 10:128000005-128000027 CAGCAACAGAAGGAACATTCTGG - Intronic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1076587668 10:131560428-131560450 CAGCAACAGCCGCAGGGTTGAGG - Intergenic
1076681727 10:132175700-132175722 CATCTCCAGCAGCAGCATGGAGG - Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1079399280 11:20092825-20092847 CAACAACAGCAGCAGCATCATGG - Intronic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1083475114 11:62910316-62910338 CAGCGACAGCAGCGGCCTGGAGG + Exonic
1083564888 11:63705488-63705510 CACCAACAGCAACAAAATTGTGG + Intronic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084222853 11:67695248-67695270 AAGCAACACCAGCTGCAGTGAGG + Intergenic
1084384914 11:68837533-68837555 CAGCCACAGTAGCAGCATGAAGG + Intronic
1084386254 11:68844195-68844217 CTGCAACTGCAGCCGCACTGGGG + Intronic
1084685640 11:70693390-70693412 CAGCAAGTGCAGAAGCACTGGGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084785201 11:71438062-71438084 AAGGAACAGCCCCAGCATTGAGG - Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1086462820 11:87022468-87022490 GACCAACAACAGCAGCTTTGAGG - Intergenic
1086917253 11:92545117-92545139 CAGGAACAGCAACAGCCTTGGGG - Intronic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1088009249 11:104979348-104979370 CTGAAAGAGAAGCAGCATTGGGG + Intergenic
1088409105 11:109513869-109513891 CAGGAACATCAGCAGCTCTGGGG - Intergenic
1088891296 11:114046776-114046798 CAGCAATAACAGCAACATAGTGG - Intergenic
1089335319 11:117718912-117718934 TAGCCACAGCAGCAGAGTTGAGG - Intronic
1089678418 11:120105924-120105946 CAGCAACAAAAGCAGCAGTCAGG + Intergenic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091850399 12:3692644-3692666 CAGCAGTGGCAGCAGCATGGTGG + Intronic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1093136833 12:15461997-15462019 AAGCAACAGAAACAGCCTTGGGG - Intronic
1094356472 12:29583466-29583488 AAGCAACAGCAGCAACACAGTGG + Exonic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094783267 12:33817920-33817942 CAGCAACTGCAGCAGTGTGGTGG + Intergenic
1096111829 12:49033420-49033442 CAGCAACAGCAGCAGGGTCCTGG - Exonic
1096111864 12:49033645-49033667 CAGCAGCAACAGCAACATTCTGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096377930 12:51129846-51129868 AAGCAGCAGCAGCTTCATTGGGG + Intronic
1097199817 12:57268972-57268994 CAGCCAGAGGAGCAGCATGGGGG - Exonic
1097585378 12:61509421-61509443 TAGCAACAGCAGCAGCAACTGGG - Intergenic
1097633786 12:62097063-62097085 AAGAAACAGAAGCAGAATTGTGG - Intronic
1099684998 12:85874074-85874096 AAGCAGCAGCAGCAGCAATTAGG + Intergenic
1099697870 12:86044359-86044381 CAGCAGCAGTGGCAGCATGGTGG + Intronic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101340869 12:103841085-103841107 CAGCGACAGCGGCGGCTTTGCGG - Exonic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101740466 12:107495987-107496009 CAGCAACAGTGGCAGAATTGAGG - Intronic
1102775850 12:115518420-115518442 GAGAAACAGCAGCAGCACTTGGG + Intergenic
1102843973 12:116157903-116157925 CAGCAACAGTAGGAGCAAAGAGG + Intronic
1102851153 12:116246656-116246678 CAGACACAGCTGAAGCATTGTGG + Intronic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103005404 12:117416642-117416664 CAGCATCAGCATCAGCAGTCAGG + Intronic
1103018697 12:117516093-117516115 CCGGAACACCTGCAGCATTGTGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103996746 12:124834937-124834959 CAGCAACATCAGCATCACTTGGG + Intronic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104759617 12:131289159-131289181 CAGCAACAGCAGCAGCCGATGGG + Intergenic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104921252 12:132291891-132291913 CCGCAAGTGCAGCAGGATTGGGG - Intronic
1104987619 12:132605884-132605906 CAGCACCAGGAGCAGCCCTGGGG - Intronic
1105249551 13:18685658-18685680 CAGCAAGAGCTGCTTCATTGAGG - Intergenic
1106020346 13:25908592-25908614 CAGCAACTGTAGCAGCCATGGGG - Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107026281 13:35804868-35804890 CAGCCACAGAGGCAGCATCGGGG + Intronic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1107920012 13:45196783-45196805 CTCCAACAGCAACAGCATTGGGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108884686 13:55165402-55165424 CACCAGCAGCAGCTGCATGGTGG - Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1109822607 13:67677984-67678006 CAGCAACATCAGTAACATTTGGG - Intergenic
1111888672 13:94054478-94054500 CAGCAGCATCAGCAGCACTTGGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112655716 13:101450840-101450862 CAGCAACATCAGCATCATTTGGG - Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113346045 13:109479635-109479657 GAGCACCAGCAGAGGCATTGTGG - Intergenic
1113432276 13:110261466-110261488 AAGCCACAGAAGCAGCACTGGGG - Intronic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1114408958 14:22482850-22482872 CACCTACAGCAGCTGCATTCTGG + Intergenic
1115351149 14:32397147-32397169 CAGTAGCAACAGCACCATTGTGG - Intronic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117547083 14:56802294-56802316 CAGCAACAACAGCAGAATGGAGG - Exonic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1118329251 14:64802967-64802989 CAACAATAGCAGCAGAGTTGGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1120281068 14:82438583-82438605 CAGCAACAGCAGCATCTCTTGGG - Intergenic
1120524188 14:85558701-85558723 CAGCCATCACAGCAGCATTGAGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1121933856 14:97998305-97998327 CTCCAACAGAGGCAGCATTGTGG + Intergenic
1122500421 14:102194464-102194486 AAGCAGCAGCAGCAGCATGTGGG - Intronic
1122521728 14:102348854-102348876 CAGAATCAGCAACAGCACTGAGG + Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124801621 15:32838493-32838515 CACAAACAGCAGCAGCCGTGGGG + Intronic
1124962716 15:34410364-34410386 CAGCATCACCAGCACCAGTGAGG + Intronic
1124979342 15:34556586-34556608 CAGCATCACCAGCACCAGTGAGG + Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1125973772 15:43933480-43933502 CAGCAACAGCAGCATCACCTGGG - Intronic
1126374963 15:47988509-47988531 CAACATCAGCAGCAGCATCCAGG + Intergenic
1126516110 15:49539740-49539762 CAGCATCTGCATCTGCATTGTGG - Intronic
1127053752 15:55111476-55111498 CAGCAACATCAGCATCATCTGGG + Intergenic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127884506 15:63187839-63187861 CAGCAGCAGCAGCAGCCCTCTGG + Intergenic
1128695718 15:69760969-69760991 CTGAAACAGGAACAGCATTGAGG + Intergenic
1129479795 15:75814523-75814545 CAGCCACACCACCAGCACTGGGG + Intergenic
1129564988 15:76612209-76612231 CAGCAGCAGCAGCAGCTTTTTGG - Intronic
1129649014 15:77466682-77466704 CAGCAGCACATGCAGCATTGTGG - Intronic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1130168964 15:81492322-81492344 CAGCAGCAGGAGCTGCTTTGGGG + Intergenic
1130555130 15:84917355-84917377 CAGCAACAGCAGGTGCCTTGGGG - Intronic
1131845630 15:96487868-96487890 AAGCAGCAGCAGCTGCCTTGAGG - Intergenic
1131902241 15:97100379-97100401 CAGCAACAGTAGCAGCACTTTGG - Intergenic
1132202560 15:99964898-99964920 CTGAAAGGGCAGCAGCATTGTGG + Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133337832 16:5017649-5017671 CAGAAGCCGCAGCAGGATTGGGG + Exonic
1133481556 16:6175721-6175743 CAGCAGCAGCGGCACCAATGGGG - Intronic
1134336151 16:13301398-13301420 CAGCAACAGCAGCATTATGTGGG - Intergenic
1134743923 16:16572790-16572812 TAGCAACAGCAGCAGTATGCTGG - Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135001559 16:18780961-18780983 TAGCAACAGCAGCAGTATGCTGG + Intergenic
1135189272 16:20341592-20341614 CAGCAGCATCAGCAGCATCCAGG - Intronic
1135233079 16:20727858-20727880 CAGCAACATCAGCATCATCTGGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136459867 16:30403261-30403283 CAGCAGCAGCAGCAGCTTGTGGG - Intergenic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137723686 16:50642680-50642702 CAGCAACAGTAGCTGCAGTTAGG + Intergenic
1137783339 16:51115972-51115994 CAGGAGCAGCAGCAGCATACTGG - Intergenic
1137829217 16:51527611-51527633 CATCAACAGCAGTAGCAACGTGG - Intergenic
1137953916 16:52809815-52809837 GAGCAACAGCAGGAGCAAAGGGG + Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138382048 16:56609256-56609278 CAGCAGGAGCAGCAGCCTGGGGG - Exonic
1138383335 16:56618582-56618604 CAGCAGGAGCAGCAGCCTGGGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139512041 16:67433041-67433063 AAGCAACAGCAGCAGCACAAAGG - Intronic
1139659429 16:68410833-68410855 CAGGAACACCTGCAGCATCGAGG + Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141447319 16:84069475-84069497 CAGCAACAGCAGTGGCACTCAGG + Intronic
1141622999 16:85247055-85247077 GAGCAGCAGCAGCAGCCCTGGGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142011969 16:87720053-87720075 GAGCCAAAGCAGCTGCATTGAGG - Intronic
1142023217 16:87797169-87797191 CAGCAGCATCAGGAGCACTGTGG + Intergenic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143745437 17:8990678-8990700 CACCAACATCAGCAGGATTTAGG + Intergenic
1144066858 17:11632231-11632253 CATCAACAGCCCCAGCAATGGGG - Intronic
1144438290 17:15260710-15260732 CAGCAACAGGAGGAGCATTCTGG + Exonic
1144458876 17:15441407-15441429 CAGCAACATCAGTATCATTTAGG - Intronic
1144701998 17:17346291-17346313 CATCACCAGCAGCACCAGTGTGG + Intronic
1145276998 17:21437505-21437527 CAGCAGCAGGAGCAGGGTTGAGG - Intergenic
1145819287 17:27818975-27818997 CAGCAACAGCTGAAAAATTGAGG + Intronic
1146024713 17:29309702-29309724 CAGAAACAGCTGCAGCATCATGG + Intergenic
1146604442 17:34246304-34246326 GCGGAACAGCAGCAGCACTGAGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149015253 17:51901493-51901515 CAGCAACTGCAGCAGCATCATGG + Intronic
1149896070 17:60429454-60429476 CAGCAACATCAGCGGCATGAAGG + Exonic
1150228241 17:63535290-63535312 CAGCATGAGCAGCGGCACTGAGG - Intronic
1150730784 17:67691652-67691674 CAGAAACAACAGCATCTTTGTGG + Intronic
1150930245 17:69576901-69576923 CAGCAACAGTGCCAGGATTGAGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151204839 17:72498852-72498874 CAGCGACATCAGCATCATTTGGG - Intergenic
1151530063 17:74698415-74698437 CACCAAAAGCAGCAGCAATATGG + Exonic
1151756768 17:76079724-76079746 CAGCCTAAGCAGCAGCATGGAGG - Exonic
1152371173 17:79889447-79889469 TAGCAGCAGTAGCAGCAATGGGG - Intergenic
1152821960 17:82441931-82441953 CAGCAACAGCAGCAGTTCTCAGG - Intronic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1155707030 18:28828662-28828684 CAGCAACAGTAGCAGGATTTTGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156112676 18:33746281-33746303 CAGCAACAACAGCAGCTCTGTGG + Exonic
1156156560 18:34309588-34309610 CAGCAATAGCAGCAAGATGGTGG - Intergenic
1156173320 18:34512642-34512664 CAGTAACACCACCACCATTGTGG - Intronic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1156791198 18:40976602-40976624 TGGCAACAGCAGCAGCTGTGGGG + Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157981101 18:52381487-52381509 CAGGAGCAGGAGCAACATTGAGG + Intronic
1158426620 18:57346287-57346309 CAGCAACAGCAGCTGCTTCTTGG + Intergenic
1158476702 18:57786482-57786504 CAGCAACATCAGCATGACTGGGG - Intronic
1158758032 18:60349940-60349962 CAGCAGCAGCCGCAGCCTTCTGG - Intergenic
1158879135 18:61759954-61759976 CAGGTACAGCAGCTGCATGGCGG + Intergenic
1159039365 18:63309199-63309221 CAGCATCAGCAGTAGCATTTAGG + Intronic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160347340 18:78144565-78144587 AAGCAACGACAGCTGCATTGGGG + Intergenic
1160374516 18:78401349-78401371 CACCAACAGCAGCACCACAGGGG - Intergenic
1160418866 18:78730700-78730722 CAGAAACAGCAGCAGCTTACAGG + Intergenic
1160782719 19:884969-884991 CAGCCAGACCAGCAGCATCGTGG - Exonic
1160800941 19:968454-968476 CAGCAACAGCATCAGCATGTCGG + Exonic
1160859758 19:1232795-1232817 CCTCAACAGCAGCAGAGTTGTGG + Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161645803 19:5452671-5452693 CAGCATCAGCACCTGCACTGCGG - Intergenic
1161694603 19:5759095-5759117 CTAAAACAGCAGCAGCACTGGGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163175939 19:15564122-15564144 CAGCAGCAGGAGCAGCCATGGGG - Intergenic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1163741624 19:19017472-19017494 CAGCCTCAGCTGCAGCACTGAGG - Intronic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164386571 19:27776133-27776155 CAGCAGCAGCAGTACCATTCAGG + Intergenic
1164711662 19:30361282-30361304 CAGCAGCAGTAGCAGCATCAAGG - Intronic
1164711779 19:30362011-30362033 TAGGACCAGCAGCAGCAGTGAGG - Intronic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165939640 19:39408573-39408595 CAGCAGCGGCAGCAGCCTGGGGG + Exonic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167358201 19:49016697-49016719 CAGCAACAGCAGCAGCCCCTGGG + Exonic
1167359699 19:49023586-49023608 CAGCAACAGCAGCAGCCCCTGGG + Exonic
1167361432 19:49032499-49032521 CAGCAACAGCAGCAGCCCCTGGG - Exonic
1167362221 19:49036286-49036308 CAGCAACAGCAGCAGCCTCTGGG + Exonic
1167363862 19:49044572-49044594 CAGCAACAGCAGCAGCCCCTGGG - Exonic
1167364636 19:49048355-49048377 CAGCAACAGCAGCAGCCCCTGGG + Exonic
1167365921 19:49054991-49055013 CAGCAACAGCAGCAGCCCCTGGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167655197 19:50759134-50759156 CAGCACCAGCAGCAGCCTCTTGG - Intergenic
1167656996 19:50771361-50771383 CAGCACCAGCAGCAGCCTCTTGG - Exonic
1167734333 19:51282666-51282688 CAGCACCATCAGCCTCATTGGGG + Intergenic
1168571415 19:57474157-57474179 CAGCACCAGAAGCAGCACAGTGG - Exonic
1168573994 19:57492933-57492955 CAACACCAGAAGCAGCACTGTGG + Exonic
1168575652 19:57506435-57506457 CAACACCAGAAGCAGCACTGTGG + Exonic
1168618663 19:57858821-57858843 CAGCACCAGAAGCAGCATATTGG + Exonic
1168624843 19:57909847-57909869 CAGCACCAGAAGCAGCATATTGG - Exonic
1168628970 19:57942383-57942405 CAGCACCAGAAGCAGCATGTTGG - Exonic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926192088 2:10735969-10735991 CAGCAACACCAGCATCACTGGGG - Intronic
926203004 2:10814579-10814601 CAGCAACAGCAGCAAATTTAAGG - Intronic
926529852 2:14030807-14030829 CAGCAACAACAGCATCACTTTGG + Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927022097 2:19028102-19028124 AAGAAACAACAGCAGCATGGTGG + Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927199301 2:20568504-20568526 CAGCAACAGGATCAGACTTGTGG + Intronic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
928382512 2:30831536-30831558 CAGAAACTGCATCAGCATTAAGG - Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928611859 2:32999151-32999173 CAGCATCATCAGCAGCATCTGGG + Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929123085 2:38499456-38499478 CAACAACATCAGCATCACTGGGG + Intergenic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930209214 2:48617344-48617366 CAGCAGCATCAGCAGCATCTGGG - Intronic
930857068 2:56030251-56030273 CAACAACATCAGCAGTTTTGGGG - Intergenic
931046811 2:58363076-58363098 CAGCAAAAGCAGCAGCAATTGGG - Intergenic
931222867 2:60304103-60304125 CAGCATCAGCATCAGCATCACGG - Intergenic
931569189 2:63650320-63650342 CAGCAGCATAAGCATCATTGGGG - Intronic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932086215 2:68764709-68764731 GAGGAACAGCAGCAGCATGGAGG - Intronic
932309138 2:70725875-70725897 CAGCAACACTGGCATCATTGGGG - Intronic
932366703 2:71157570-71157592 AAGCTTCTGCAGCAGCATTGGGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
934715648 2:96541871-96541893 CAGCAGCAGCAGCAGCTATCAGG + Intronic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934943344 2:98518492-98518514 GCCCAGCAGCAGCAGCATTGTGG + Intronic
936470995 2:112798398-112798420 GAGGAACACCAGCAGCAATGAGG - Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
936743494 2:115544789-115544811 CACCACCACCAGCAGCAGTGAGG - Intronic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
936848406 2:116866655-116866677 CTGCAAGAGCAGCAGATTTGGGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937318108 2:120944868-120944890 CAGCAGCAGCAGCATCCCTGTGG + Intronic
937621899 2:123998094-123998116 CAGGAATGACAGCAGCATTGGGG - Intergenic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
939089108 2:137757898-137757920 CAGCAGCAGTGGCAGCATGGTGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939513191 2:143132646-143132668 CAGCTACAGCTGCAGCACTTGGG + Intronic
940046072 2:149411083-149411105 CAGCAACATCAGCATCATCTAGG + Intronic
940276204 2:151943287-151943309 CAGAACCAGCAGCACTATTGGGG - Intronic
940409212 2:153340908-153340930 CAGCAACATCAGCATCATCCAGG + Intergenic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941291042 2:163675426-163675448 CAGCAGCAACAGCATCACTGGGG + Intronic
941317336 2:164009591-164009613 CAACAACAGCAACAGCAATACGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
941998323 2:171622547-171622569 CATCATCAGCAGCAGCACTTTGG + Intergenic
942139780 2:172966459-172966481 GAGCAGCAGCAGCAGCATCTGGG - Intronic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942467524 2:176224362-176224384 CAGTCACAGAAGCAGAATTGAGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943801218 2:192060337-192060359 GACCAACAGCAGCAGCATCTGGG - Intronic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
944643784 2:201756854-201756876 CAGCAGCATCAGCAGCATCTGGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945766808 2:213990922-213990944 CAGCAACAGCAGTAGCTTACAGG + Intronic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947119292 2:226799342-226799364 CAGCAACAGCCGCAGCGCCGCGG - Exonic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947967028 2:234290395-234290417 CAGGAACAGCAGGAGGTTTGAGG - Intergenic
948664529 2:239526772-239526794 CACAAAAAGCAGCAGCATTTGGG + Intergenic
1168875610 20:1170142-1170164 CAGCAACAGCAGCATCACCTGGG + Intronic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1169816359 20:9660915-9660937 CAGCAGCATCAGCATCACTGGGG + Intronic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170331199 20:15212823-15212845 CAGCAGCATCAGCAGCATCTGGG + Intronic
1170855299 20:20047704-20047726 CAGGAGCAGCAGCAGCATCCAGG + Intronic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172520508 20:35562654-35562676 CAGCAACAGGAGCTGCAGTCAGG + Intergenic
1172555853 20:35840661-35840683 CAGCAGCAGCAGCAACATCTGGG + Intronic
1172573859 20:35991842-35991864 CAGCAGCACCAGCAGCACTTGGG + Intronic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173848518 20:46203009-46203031 GAGGAGCAGCAGCAGCATGGAGG - Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174063706 20:47849889-47849911 CAGCAACAGTGTCAGGATTGGGG + Intergenic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175246567 20:57585857-57585879 CAGCGACAGCAGCAGCACCTGGG + Intergenic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175446611 20:59024432-59024454 CAGGAACAGCAGCTGCTTTGTGG + Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175597856 20:60249742-60249764 CAGCAGCATCAGCATCACTGGGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176798622 21:13397967-13397989 CAGAAGCAGCAGCTGCATAGTGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178298549 21:31431414-31431436 CAGCAACATCAGCATCATCTGGG - Intronic
1178728060 21:35072770-35072792 GGCCAACAGCAGCAGCAGTGTGG + Intronic
1178966614 21:37125706-37125728 AAGAAACAGAAGCAGCAATGTGG - Intronic
1179075077 21:38113416-38113438 CAGTCACACCAGCAGCATTTTGG + Intronic
1179199162 21:39199405-39199427 TAGCTACAGCAGAAGCATTGCGG + Exonic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179831524 21:44000110-44000132 CACCAACAGCATCAGCAATAAGG - Intergenic
1179998730 21:44985636-44985658 AAGCAAAAGCACCAGCTTTGTGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181058781 22:20272213-20272235 AAGCCACAGCAGCAGCAAAGGGG + Intronic
1181078182 22:20395167-20395189 CACCAACAGAAACAGCATCGAGG - Intronic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181829059 22:25544754-25544776 CAGTAACAACAGCAGCGTGGTGG - Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182715212 22:32352685-32352707 CAGCAGCAGCAGCAAGTTTGGGG - Intergenic
1182788062 22:32924487-32924509 CAGCAGCATCAGCAGCATCCAGG + Intronic
1182797649 22:33002948-33002970 CCACAAGAGCAGCAGCATGGGGG - Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
949934691 3:9107615-9107637 CAGCAGCAGCAGCATCACTTAGG + Intronic
950602545 3:14047183-14047205 CAGAAACAGGAGCTGCATTAGGG - Intronic
951663377 3:25095348-25095370 CAGCAACATCAGCACCATCTGGG + Intergenic
952627508 3:35424763-35424785 CAGCAAAAGCAGCAGCAATTGGG + Intergenic
952751284 3:36827015-36827037 CAGCAAAAGCAGCAGCAACATGG + Exonic
952859206 3:37798450-37798472 CAGCAGCATCAGCATCATGGGGG + Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
954206532 3:49063281-49063303 CAACAGCAGCAGCAGCATCCAGG + Intronic
954660046 3:52222167-52222189 CTGCAACAGCATCAGCTTCGTGG - Exonic
955522314 3:59786812-59786834 CAGGAACAGCTGGAGTATTGAGG - Intronic
955661937 3:61309044-61309066 CAGCAACAGCAGCATCTCTCGGG + Intergenic
956135323 3:66092786-66092808 CAGGAACAGCGGCAGAATTGTGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956689641 3:71863955-71863977 CAACAACAGCAGCAGGCTAGGGG + Intergenic
956772233 3:72536442-72536464 CAGCAACATCAGCACCAATTGGG - Intergenic
956900935 3:73715411-73715433 CCTCAACAGCAGCAGTATTTGGG - Intergenic
956933060 3:74068084-74068106 CAGCAGCATCAGCATCATTCAGG + Intergenic
958461883 3:94408229-94408251 GCACAACAGCAGCAGCATTTTGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959389200 3:105752870-105752892 CAGCAGCAGCAGCAGCCTCAGGG - Intronic
959583848 3:108007757-108007779 CAGCAACATCAGCATCACTTGGG - Intergenic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
959619674 3:108386444-108386466 CCGCCACAGCATTAGCATTGAGG + Intronic
960088415 3:113614649-113614671 CAGGAAAGGCAGCAGCAATGAGG + Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960949205 3:122988156-122988178 CAGCAGCAGCAGCATCACTTGGG - Intronic
960997088 3:123347492-123347514 AAGCAACACCAGCCGCTTTGGGG - Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962289584 3:134122943-134122965 ACCCAACAGCAGCAGCAGTGGGG + Intronic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963430008 3:145188614-145188636 CAGCAGCACCAGCAGCATCTGGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963989568 3:151637657-151637679 CAGCAGTACCAGCAGCATTTGGG - Intergenic
964152306 3:153541936-153541958 AACCAACAGCAGCAGCACTTGGG + Intergenic
964310703 3:155388638-155388660 AAGCCACAGCAGCAGCTCTGGGG - Intronic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
966986887 3:185189013-185189035 GAGCAACTGCAGCTGCATGGTGG + Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
968509609 4:989658-989680 CAGCACCAGCAGCACCACGGTGG + Exonic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969346087 4:6570974-6570996 CAGCCACAGCACCAGCTTGGAGG + Intergenic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
969948678 4:10811302-10811324 CAGCAACATCTGCATCACTGGGG - Intergenic
970098247 4:12489355-12489377 CAGTAACAGCATAAGCATGGAGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970384120 4:15538872-15538894 CAGCAGCATCAGCATCACTGAGG + Intronic
970441730 4:16085872-16085894 CCCCAGCAGCAGCAGCCTTGTGG + Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
971160126 4:24125438-24125460 GACTAACAGCAGCAGCTTTGGGG - Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
971592490 4:28485688-28485710 CAGCATCAGCTGGGGCATTGTGG - Intergenic
971817493 4:31507084-31507106 CATGAACAGCTGCAGCAATGAGG + Intergenic
971894770 4:32578559-32578581 GTCCAACAGCAGCAGCATTTTGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972311997 4:37890832-37890854 GAGCAACAGCTGCTGCACTGCGG - Intergenic
972388880 4:38593805-38593827 CAGCAACATCAGCACCACTTGGG + Intergenic
972438051 4:39053888-39053910 AAGAAACAGCAGCAGCAATTGGG + Intronic
972503243 4:39697362-39697384 CACCAACAGCAGCAGCAACTGGG + Intergenic
972903393 4:43713189-43713211 CAGCAATAGCCACAGCATTTAGG + Intergenic
973256860 4:48122303-48122325 TGGCTCCAGCAGCAGCATTGCGG - Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973575862 4:52288721-52288743 CAGCAACATCAGCATTATTTGGG - Intergenic
973851183 4:54963144-54963166 CAGCAAGAGAAGCAGCCATGTGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974094739 4:57351026-57351048 CAGCAAGGGCAGTACCATTGTGG + Intergenic
976911272 4:90309175-90309197 TTGTAACAGCAGCAGAATTGAGG - Exonic
977289591 4:95149688-95149710 GAGGAACAGCAGCAGCATCAAGG - Intronic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978329291 4:107594885-107594907 CACCAACAGCAGCAGGCTTTCGG - Intronic
978940820 4:114434494-114434516 CAGTAGCAGTAGCAGCATTATGG + Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979241938 4:118454903-118454925 CAGGAACAGCCTCAGCATAGGGG - Intergenic
980602715 4:135045802-135045824 CAACACCAGCAGCAACATTCAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981354705 4:143774723-143774745 GAGCAACAGCAGCAGAAGTTTGG + Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
983609006 4:169621714-169621736 CAGTTACTGCAGCATCATTGTGG + Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984810960 4:183796552-183796574 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
984818206 4:183857720-183857742 CAGGGACACCAGCAGCACTGGGG - Intronic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
986989079 5:13530772-13530794 CATCAATATCAGCAGTATTGTGG - Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989426500 5:41302022-41302044 CTGAAAAAGCAGCAGCTTTGGGG - Intergenic
991421215 5:66444200-66444222 CACCAGCAGCAGCAGCATTAGGG + Intergenic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
994657129 5:102607786-102607808 CAGCAACATCAGCACCACTGGGG - Intergenic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995258584 5:110075259-110075281 TAGCAGCAGCAGCAGCTTGGTGG + Intergenic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996468927 5:123836855-123836877 CAGCAACTATAGCAGCATGGTGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997614281 5:135235927-135235949 CAGCAACATCAGCATCATCTGGG - Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997825701 5:137105142-137105164 GAGCAGCAGCAGCAGCAATTAGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998264968 5:140660937-140660959 CAGTAGAAACAGCAGCATTGAGG + Intronic
998563285 5:143192334-143192356 CAGCACCAGCAGGAACATGGAGG + Intronic
998566538 5:143220830-143220852 CAGCAAAAGAATCAGCCTTGAGG - Intronic
999784431 5:154878713-154878735 CAGAAACAGAAGCTGCATTAGGG + Intergenic
999785457 5:154885975-154885997 CAGAAACAGAAGCTGCATTAGGG + Intergenic
1000804306 5:165770099-165770121 CAGCAACAGAAGCATTTTTGCGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000990171 5:167903715-167903737 CAGCAGCATCAGCAGCATCTGGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002780263 6:359731-359753 CAGAAGCAGAAGCAGCATTAGGG + Intergenic
1003084314 6:3049339-3049361 CAGCATGAGCACCAGCTTTGAGG + Intergenic
1003492051 6:6631550-6631572 CAGCAACATCAGCATCATCTAGG + Intronic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1003989189 6:11469076-11469098 CAGCAACATCAGCATCACTCAGG - Intergenic
1004120164 6:12813843-12813865 CAGCAGCATCAGCATCCTTGCGG + Intronic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004518897 6:16344029-16344051 CAGCAGCATCAGCAGCATCTGGG - Intronic
1005555208 6:26972576-26972598 GAGTCACAGCAGCAGGATTGAGG + Intergenic
1005994680 6:30924010-30924032 CAGCAGCAGCAGCACCACTTGGG - Intronic
1006113617 6:31763520-31763542 CAGCGACAGCAGCTGCATCTAGG + Exonic
1006339921 6:33441278-33441300 AACCAACAGCAGTAGCTTTGAGG + Exonic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007415914 6:41691074-41691096 CAGCAACAGCAGCAGCTCGGAGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007962457 6:45972596-45972618 CAGCAACATCAGCATCCTTTAGG + Intronic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010731871 6:79399658-79399680 CAGTACCAGCATCAGCATTCTGG + Intergenic
1010748667 6:79593445-79593467 CAGCTACAGAGGCAGCGTTGAGG + Intergenic
1010855030 6:80827154-80827176 AAACAACAGCAAAAGCATTGAGG - Intergenic
1010989925 6:82469228-82469250 CAGCAGAAACAGCAGCTTTGTGG + Intergenic
1011461237 6:87606690-87606712 CAGCTACATCAGCTACATTGTGG + Intronic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012790660 6:103690382-103690404 TAGCAACAGCAGCAGCACCTAGG - Intergenic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014209718 6:118695562-118695584 CAGCAACATCAGCATCACTTGGG - Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1015780302 6:136858509-136858531 AAAAAACAGCAGCAGAATTGTGG + Intronic
1015808316 6:137134196-137134218 CAGCTAAAGCAGCTGCATGGAGG + Intergenic
1016466826 6:144334211-144334233 CAGCAACAGGTGCAGCATTCCGG - Intronic
1016527100 6:145014206-145014228 CAGCAAGTGCAACAGCGTTGGGG + Intergenic
1016994384 6:149951413-149951435 CATCAGCAGCAGCAGCCATGTGG + Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018025870 6:159805230-159805252 CAGCGAGAGCAACAGCATTGTGG + Intronic
1018029340 6:159829903-159829925 CATCTTCAGCAGCAGCAATGTGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018870218 6:167776990-167777012 CAGCAAAAGCACCAGCTCTGAGG + Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019615780 7:1959869-1959891 CTGGAACAGCAGCTGCATTTAGG + Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020915802 7:14191135-14191157 CAGCACCAGCAGCAACAATCAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022203145 7:28137356-28137378 CAGCAACAGCATCTTCCTTGTGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023560620 7:41469962-41469984 CAACATAAGCAGCAGCAATGAGG + Intergenic
1024544644 7:50506818-50506840 CAGCACCAGGAGAAACATTGAGG - Intronic
1024841486 7:53592194-53592216 CAGAAGCAGCTGGAGCATTGGGG - Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026275079 7:68869445-68869467 CAGGAAGAGCAGCAGCTTTCTGG - Intergenic
1026681096 7:72467259-72467281 CAGCCCCACCAGCAGGATTGGGG - Intergenic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027438735 7:78195662-78195684 CAACATCAGTAGCAGCATTCTGG - Intronic
1027516727 7:79151073-79151095 CAATAACAGAAGCAGCACTGAGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028259097 7:88639351-88639373 CAGCACCAGCAGCAACAATCAGG - Intergenic
1029098330 7:98106918-98106940 CAGCAACGCCAGCAGCCCTGCGG - Exonic
1029331410 7:99859255-99859277 CAGCAGCACCAGCAGCATCTGGG - Intronic
1029383874 7:100231011-100231033 CAGCCACAGGCGCAGCACTGAGG - Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1030393782 7:108960399-108960421 AAGCCACAGAAACAGCATTGGGG + Intergenic
1030462300 7:109854562-109854584 GTTCAACAGCAGTAGCATTGGGG - Intergenic
1030769733 7:113459106-113459128 CAGCAAGAGAAGCAGCAATGTGG - Intergenic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1030989178 7:116279886-116279908 CAGCCATAGCAGCAGCGCTGGGG - Intergenic
1031140966 7:117943231-117943253 TAACAACAGCAGCAGCAAAGAGG + Intergenic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033645343 7:143298145-143298167 CAGCAACAGCAGCATCACCCAGG - Intronic
1033765693 7:144488052-144488074 CAGCAGCAGCAGCATCCCTGGGG + Intronic
1033791151 7:144793425-144793447 CAGCAGTGGCAGCAGCATTTTGG - Intronic
1034279729 7:149844688-149844710 CAGCAACAGAAGGAGCTCTGTGG + Exonic
1034323014 7:150203104-150203126 CAGCAGCATCAGCATCATTTCGG + Intergenic
1034331530 7:150287352-150287374 CAGCAGCAGCAGCATCCTGGCGG - Intronic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034386038 7:150742204-150742226 CTGCAACACCACCGGCATTGAGG + Exonic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034666513 7:152822509-152822531 CAGCAGCAGCAGCATCCTGGCGG + Intronic
1034770167 7:153766003-153766025 CAGCAGCATCAGCACCATTTGGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035096597 7:156361127-156361149 CTAAAACAGGAGCAGCATTGAGG + Intergenic
1036391459 8:8327934-8327956 GAGCAACATCAGCAGCAAGGAGG - Exonic
1036585795 8:10122133-10122155 CAACAACACCAGCAGCATGCTGG - Intronic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1040605604 8:48928205-48928227 CAGCAACTGCAACATCATTCTGG - Intergenic
1041429136 8:57759220-57759242 CAGCAACAGTGGCAGCATGGTGG - Intergenic
1041568947 8:59313809-59313831 CAACAACAACAGCAGCAATATGG - Intergenic
1041683557 8:60619983-60620005 CTGCAACAGTAGTAGCCTTGGGG - Intronic
1042036062 8:64535270-64535292 CAGCAAAAGAAGCAGCTATGAGG + Intergenic
1042656020 8:71097424-71097446 AGGCAACAGCAGCAGAAATGAGG - Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1042915868 8:73875581-73875603 CAGCAGCAGCAGCAACATCCTGG + Intronic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1044117168 8:88349954-88349976 CAGCAACTACAGGAGCATTCAGG - Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044407122 8:91840402-91840424 CAGCAGCATCAGCATCATTTGGG - Intergenic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046747749 8:117894366-117894388 CACCAACAGGACCAGCATGGAGG - Intronic
1047199688 8:122754603-122754625 GAGGAAAAGCAGCAGCAATGTGG + Intergenic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1047890572 8:129303776-129303798 AAGCACAAGCACCAGCATTGAGG + Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048265461 8:132981641-132981663 CAGCAGCAACAGCAGCGCTGGGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048310598 8:133319728-133319750 CAGCAATAGGACCAGCATAGGGG - Intergenic
1048583723 8:135752954-135752976 CATCAACAACCTCAGCATTGTGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048925241 8:139265463-139265485 CAGGAAGAGCTGCAGAATTGGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1049713332 8:144077426-144077448 CAGCTGCAGCAGCAGGGTTGTGG + Intergenic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050646061 9:7720831-7720853 CAGCAACATCAGCAGCACCTAGG - Intergenic
1050702741 9:8359217-8359239 CAGCAGCATCAGCAGCATGTAGG + Intronic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052437223 9:28444375-28444397 ATGCAACAGAAGCAGCAGTGGGG + Intronic
1052746909 9:32449965-32449987 AAGAAACAGAAGCATCATTGAGG - Intronic
1053020930 9:34693453-34693475 CAGCAGCAGCAGCATCACTTGGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053399993 9:37810411-37810433 CAAAAGCAGCAGCAGCAATGAGG + Intronic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056364253 9:85887242-85887264 CAGCAGCATCAGCAGCATCTGGG - Intergenic
1057051921 9:91930441-91930463 CAGAAACAGAAGCTGCATTAGGG + Intronic
1057344001 9:94231296-94231318 CACCAACAGAAGCAGCATCCAGG - Intergenic
1057516585 9:95727149-95727171 CACCAACAGCAGCATCATGTGGG - Intergenic
1057599946 9:96449595-96449617 CAGCAAGTGCAGCAGTCTTGAGG - Intergenic
1058000171 9:99856830-99856852 CAGCAGCATCAGCATCACTGGGG - Intronic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1058497410 9:105574593-105574615 CAGCAGCACCAGCATCATTTGGG + Intronic
1059259498 9:112962244-112962266 CAGCAACAGCAGCATCATCTTGG + Intergenic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1060040335 9:120294841-120294863 CATCAACAGCAGCAGCATTCTGG + Intergenic
1060045686 9:120338322-120338344 CAGGATCAGGAGCAGCTTTGTGG - Intergenic
1060240565 9:121898915-121898937 CAGCAACAGAAGCAGGCATGAGG - Intronic
1060504119 9:124185525-124185547 CAGCCACAGCAGCAGCACCTGGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186670474 X:11762479-11762501 AAGCACAAGCAGCAGCATTCTGG - Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187525478 X:20050262-20050284 CAGCAATGGCAGCAGCATCTAGG - Intronic
1187537394 X:20155262-20155284 CAGCAGGAACAGCAGCATTATGG + Exonic
1187566498 X:20454710-20454732 CAGCAACAACAGCATCATCAGGG - Intergenic
1187990921 X:24871349-24871371 CAGCAACATCAGCATCATTTGGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188612049 X:32112344-32112366 CAGCAACATCAGCACCATCTGGG - Intronic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188749075 X:33883874-33883896 CAACAACACCAGCAGCATCTTGG + Intergenic
1188835456 X:34948706-34948728 CAGCTGCTGCAGCAGCATTGCGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189131498 X:38502742-38502764 TAGAGACAGCAGCAGCACTGGGG + Intronic
1189152281 X:38720727-38720749 CAGGAACAGGAGCAGAATTAGGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190233908 X:48601702-48601724 CATCAACAGCAGCCCCACTGTGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190745082 X:53317715-53317737 CAGCAGAGGCTGCAGCATTGGGG - Intronic
1190952922 X:55163349-55163371 CAGCATCACCAGCAGGATTTGGG + Intronic
1190973829 X:55379750-55379772 CCCCAATAGCAGCAGCATGGTGG - Intergenic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191685529 X:63885512-63885534 CAGGCACAGCAGCAGGTTTGTGG - Intergenic
1191840849 X:65512834-65512856 CAGCAGCAGCAGCAACTTCGAGG - Exonic
1192224123 X:69216832-69216854 GAGCAACAGCTGCAGCATGAAGG + Intergenic
1192232828 X:69277837-69277859 CAGCAGCAGCAGCAACTTTGGGG + Intergenic
1193251804 X:79299401-79299423 CAGCAACAACAACAAAATTGTGG + Intergenic
1193569695 X:83127560-83127582 CAGCAACAGCTCCAGCAATAAGG + Intergenic
1193821603 X:86171698-86171720 CAGCAGCAACAGCAGCATGTGGG - Intronic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1194542885 X:95196555-95196577 CAGAAGCAGCGGCAGCATGGTGG + Intergenic
1194561454 X:95427252-95427274 CACCCACAGCAGCAGCCTGGTGG + Intergenic
1195047271 X:101065458-101065480 CAGCAACATCAGCATCACTTGGG - Intergenic
1195341457 X:103910867-103910889 CAGCAACAGCAGCAGCTCCAAGG - Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196494471 X:116307778-116307800 AAACCCCAGCAGCAGCATTGTGG - Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1199146890 X:144379402-144379424 CAGCAGTGGCAGCATCATTGTGG + Intergenic
1199988150 X:152967161-152967183 CTGCAGCGTCAGCAGCATTGAGG + Exonic
1200052230 X:153440359-153440381 CAGGAACAGTATCAGCATTGTGG - Intergenic
1202389647 Y:24356728-24356750 CAGGAACAGCCTCAGCATAGGGG - Intergenic
1202481137 Y:25313386-25313408 CAGGAACAGCCTCAGCATAGGGG + Intergenic