ID: 1127474603

View in Genome Browser
Species Human (GRCh38)
Location 15:59321658-59321680
Sequence CTAGTAGTCCCCATGTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127474603_1127474607 -8 Left 1127474603 15:59321658-59321680 CCAATAGACATGGGGACTACTAG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1127474607 15:59321673-59321695 ACTACTAGAGGCAGGAGAGAGGG 0: 2
1: 16
2: 60
3: 197
4: 735
1127474603_1127474609 -2 Left 1127474603 15:59321658-59321680 CCAATAGACATGGGGACTACTAG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1127474609 15:59321679-59321701 AGAGGCAGGAGAGAGGGAGGTGG 0: 2
1: 17
2: 92
3: 778
4: 4511
1127474603_1127474610 -1 Left 1127474603 15:59321658-59321680 CCAATAGACATGGGGACTACTAG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1127474610 15:59321680-59321702 GAGGCAGGAGAGAGGGAGGTGGG 0: 2
1: 7
2: 65
3: 613
4: 4379
1127474603_1127474608 -5 Left 1127474603 15:59321658-59321680 CCAATAGACATGGGGACTACTAG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1127474608 15:59321676-59321698 ACTAGAGGCAGGAGAGAGGGAGG 0: 3
1: 7
2: 32
3: 193
4: 1230
1127474603_1127474606 -9 Left 1127474603 15:59321658-59321680 CCAATAGACATGGGGACTACTAG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1127474606 15:59321672-59321694 GACTACTAGAGGCAGGAGAGAGG 0: 2
1: 18
2: 64
3: 199
4: 865

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127474603 Original CRISPR CTAGTAGTCCCCATGTCTAT TGG (reversed) Intronic
900821164 1:4889867-4889889 ATAGTAGAACCCATGTCAATAGG - Intergenic
903491576 1:23732664-23732686 CTGGTACTACCCAAGTCTATAGG - Intergenic
909245070 1:73270590-73270612 CTTGTAATCCCCATGTGTCTAGG + Intergenic
911119581 1:94282217-94282239 CCAGTGGTCCCCAAGCCTATTGG - Intergenic
918239846 1:182611641-182611663 CCAGGAGTCCCCATGTCAACAGG + Intergenic
918598323 1:186319995-186320017 CTAGTAGTACCTATATTTATTGG + Intronic
1063362211 10:5467967-5467989 CTACAAGTCTCCAAGTCTATTGG + Intergenic
1068508213 10:57929782-57929804 ATTGGAGTCCACATGTCTATGGG - Intergenic
1070052488 10:72902827-72902849 GTAATAGTCCCCATGTGTAAAGG - Intronic
1070466202 10:76726350-76726372 CTTCTAGTCCCCTTTTCTATGGG + Intergenic
1075621465 10:123931012-123931034 CAAGTTGTCCCCATGAATATGGG - Intronic
1078045177 11:7907265-7907287 CCAGTCTTTCCCATGTCTATTGG - Intergenic
1082810330 11:57475837-57475859 CTGGGAATCCCCATGTCTACAGG - Intronic
1083123530 11:60539518-60539540 CTGGTACTCCCCATTTTTATGGG - Intronic
1087250348 11:95892076-95892098 CTTGTAGTCACCATGGCTACTGG + Intronic
1088601491 11:111481686-111481708 ATAGTAATCCACATGTCAATAGG + Intronic
1089827982 11:121296168-121296190 CTAGTAGTCCAGATTTCTAATGG + Intronic
1111512659 13:89287237-89287259 CTAGTAGTCCTGATGTCTAGAGG + Intergenic
1113588824 13:111483936-111483958 CTAATGGTCCACATGTCCATGGG - Intergenic
1127474603 15:59321658-59321680 CTAGTAGTCCCCATGTCTATTGG - Intronic
1128806925 15:70538121-70538143 CTGGGAGACCCCATGTCTAGTGG - Intergenic
1131160207 15:90100817-90100839 CTAGAAGTCCCCATGTGGGTTGG - Intronic
1134757578 16:16681831-16681853 ACAGTATTCCCCAGGTCTATGGG - Intergenic
1134988490 16:18677335-18677357 ACAGTATTCCCCAGGTCTATGGG + Intergenic
1142475637 17:187454-187476 CTAGTGGTCCCCAGGCCTGTGGG - Intergenic
1146825402 17:36018270-36018292 CTGGTGGTCCCCATGTGTACAGG - Intergenic
1154225446 18:12499228-12499250 CTAGTTGTCCCAATATCAATTGG + Intronic
1157000034 18:43512664-43512686 CTGGTAGTCCCCATGTCCTTGGG + Intergenic
1157283950 18:46364501-46364523 CTGGTAGTCACCTTGTCTGTCGG - Intronic
1157607986 18:48938279-48938301 CTACTAGTCCCCAAGTCTGGGGG - Intronic
925606185 2:5662671-5662693 TTAAGAGTCCCCATGTCTTTTGG + Intergenic
945009046 2:205442233-205442255 CTAGAATTCCCCATATGTATTGG - Intronic
945034884 2:205696232-205696254 TTACTATTCCCCATGTCTGTTGG - Intronic
948434555 2:237944260-237944282 CTGGTAGTCCTGATGTCTGTGGG - Intergenic
1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG + Intergenic
1178019845 21:28395761-28395783 CTATTAGTGCACATTTCTATAGG - Intergenic
957853506 3:85843015-85843037 CTAGTAGTACCTATGTATATTGG + Intronic
984217455 4:176932016-176932038 TTAATAGTCCCCATGTCTTAAGG - Intergenic
992082904 5:73251976-73251998 ATATTTGTCCCCATGTCTGTTGG + Intergenic
993608355 5:90022817-90022839 CTCCTAGTCCCCATGTCTTTGGG + Intergenic
998775732 5:145599494-145599516 CCAGTAGTCATCATGGCTATTGG - Intronic
1001595241 5:172894530-172894552 CTAGTATCCCCCATGTCTCAGGG + Intronic
1005138692 6:22601414-22601436 CTAGTAATCCCCATGTGTCATGG + Intergenic
1006272583 6:32975408-32975430 TTAATAGTACCCATGTCCATAGG - Exonic
1007920378 6:45603949-45603971 CCAGTAATCCCCATGTTCATGGG - Intronic
1021087935 7:16445719-16445741 ATCCTAGTCCCCTTGTCTATGGG + Intergenic
1031603396 7:123740952-123740974 CAGGTACTCCCCATGTCTATTGG + Intronic
1033759481 7:144423749-144423771 CAAGTAGTCCCCAGGACAATGGG + Intergenic
1044399506 8:91754211-91754233 CTAATACTCACCATATCTATAGG + Intergenic
1045755823 8:105540263-105540285 CAAGTAGTCTTCATGTTTATAGG + Intronic
1060027150 9:120182918-120182940 CTACTAGTCCCCATGTGTTATGG - Intergenic
1061972462 9:134052397-134052419 TTAATAGTCCCCATATCCATTGG + Exonic
1189424629 X:40886997-40887019 CTAGTAGTCCTCAGTTCTGTTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1198277117 X:135105520-135105542 CTAGTTGTCACCTTGTCTGTGGG + Intergenic
1202088167 Y:21161046-21161068 CTGGTGGTCCCCATGTTTTTGGG + Intergenic