ID: 1127475110

View in Genome Browser
Species Human (GRCh38)
Location 15:59325740-59325762
Sequence CTGCTGTGCTTGGTGAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127475107_1127475110 -6 Left 1127475107 15:59325723-59325745 CCCAGGCTGGGGGAATACTGCTG 0: 1
1: 0
2: 3
3: 20
4: 270
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1127475100_1127475110 8 Left 1127475100 15:59325709-59325731 CCTCCATCCACTGGCCCAGGCTG 0: 1
1: 0
2: 7
3: 44
4: 439
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1127475108_1127475110 -7 Left 1127475108 15:59325724-59325746 CCAGGCTGGGGGAATACTGCTGT 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1127475103_1127475110 5 Left 1127475103 15:59325712-59325734 CCATCCACTGGCCCAGGCTGGGG 0: 1
1: 1
2: 5
3: 55
4: 548
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1127475106_1127475110 1 Left 1127475106 15:59325716-59325738 CCACTGGCCCAGGCTGGGGGAAT 0: 1
1: 0
2: 6
3: 28
4: 333
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1127475097_1127475110 17 Left 1127475097 15:59325700-59325722 CCATTAATTCCTCCATCCACTGG 0: 1
1: 0
2: 0
3: 19
4: 226
Right 1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127475110 Original CRISPR CTGCTGTGCTTGGTGAGCAC AGG Intronic
900473940 1:2867670-2867692 CTGCCGGGCTTGGAGGGCACTGG - Intergenic
900559314 1:3295864-3295886 AAGCTGTGCATGGTGAGAACTGG + Intronic
900618798 1:3577637-3577659 CTGCTGTGGATGCTGAGCCCCGG + Intronic
900744977 1:4354961-4354983 GCTCTGTGCCTGGTGAGCACAGG + Intergenic
903236966 1:21956519-21956541 CTAGTGTTCTTGGTGAGCACAGG - Intergenic
904989709 1:34582164-34582186 CTTGTGTGTTTGGTGATCACTGG - Intergenic
905182321 1:36175069-36175091 CTGGTGTTCTTGCTGAGCTCTGG - Intronic
906535950 1:46551054-46551076 CTGCTGTTCTGGGTGAGCAGGGG - Exonic
906606328 1:47174907-47174929 CAGCTGGGCTGGGTGAGCCCAGG - Intergenic
907415097 1:54308804-54308826 CTGCTTTCCTTGGTGATCAATGG - Intronic
911041758 1:93596872-93596894 CTGCTGTGTGGGGTGAGCTCAGG - Intronic
913240442 1:116825527-116825549 CAGCTGGGTGTGGTGAGCACAGG + Intergenic
914490855 1:148149369-148149391 CTGCCGTGGATGATGAGCACGGG - Intronic
915080453 1:153348542-153348564 CTGCTGGGCTGGGACAGCACAGG - Exonic
915382750 1:155457713-155457735 TTGCTGTGAGTAGTGAGCACTGG - Intronic
915968523 1:160334105-160334127 CTGCTTTGCTTGCTGAGACCTGG - Intronic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
919796654 1:201325170-201325192 CTGCTGTGCAGGGTGAGGAGGGG - Intronic
920581563 1:207113156-207113178 CTGCTGTTCTTGGTGAGTAGTGG + Exonic
921246775 1:213251477-213251499 GTGCTTTGCATGGGGAGCACTGG + Intronic
922553196 1:226512470-226512492 ATGCTGTGCTGGGAGGGCACTGG + Intergenic
922703228 1:227774520-227774542 CTGCTGTGCATGGAGGGGACAGG - Intronic
924818184 1:247461419-247461441 TTGCTCTGCTTGGTGTGAACTGG + Intergenic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1064162928 10:12961114-12961136 GTGCAGTGCTGCGTGAGCACCGG + Intronic
1065284813 10:24177036-24177058 GGGCTGTGCATGGTGGGCACAGG - Intronic
1066981466 10:42420086-42420108 CTCCTGAGTGTGGTGAGCACTGG + Intergenic
1067569079 10:47358693-47358715 CTGCTGTCCCTGCTAAGCACAGG - Intergenic
1067698537 10:48552524-48552546 GGGCTGTGCTTGGTGCACACTGG + Intronic
1067838131 10:49654220-49654242 CTGTCTTGCTTGGTGAGCAAGGG - Intronic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1074871259 10:117577861-117577883 CTGCTGTGCGTGGTCAGCGTTGG + Intergenic
1075204289 10:120433465-120433487 CTGCTCTGTTTGCTGAGCACAGG + Intergenic
1075754022 10:124796537-124796559 CTGCTCTTCTTGGTCAGGACTGG + Intergenic
1076120678 10:127934683-127934705 CTGCTGAGGTTGTGGAGCACCGG + Intronic
1076479067 10:130772497-130772519 CTGCTGTGTGGGCTGAGCACAGG - Intergenic
1076777696 10:132707221-132707243 CTGCTGTTCTTGGTGCTCATGGG - Intronic
1077206449 11:1346855-1346877 CTGCTGGGGTGGGTGAGGACAGG + Intergenic
1077235954 11:1482090-1482112 GTGCTGTGCTGTGAGAGCACAGG - Intronic
1080451430 11:32381730-32381752 AGGCTGTCCTTGGTGAGCAGAGG + Intergenic
1082262251 11:50085612-50085634 CTTCTGGGCTTGCTGAACACAGG + Intergenic
1083258864 11:61512542-61512564 CTGCTGTCATTAGTGAGCTCAGG + Intergenic
1084503035 11:69546101-69546123 CAGCTGTGCTGGTGGAGCACAGG - Intergenic
1084766139 11:71309784-71309806 CTGCTGTGATTGGTCAGTGCAGG + Intergenic
1086061800 11:82707619-82707641 CTGGTGTGCTGGGTGAGTCCTGG + Intergenic
1086280600 11:85183087-85183109 CTGCTAAGCTTGGTCAGGACTGG - Intronic
1088230609 11:107670241-107670263 CTGGTGTGCCTTGTGAGCATGGG - Intergenic
1090164756 11:124535361-124535383 CTGCTGAGCTTGGGGTGCAGAGG - Intergenic
1090838248 11:130469080-130469102 CGGGTGGGCTTGGTGTGCACTGG + Intronic
1092038122 12:5358938-5358960 CTGTTCTGTTTGGAGAGCACAGG + Intergenic
1094510042 12:31090831-31090853 CTGCTGAGCTGTGTGGGCACTGG + Intronic
1103999441 12:124851001-124851023 CTGCTGTGATTGGTCAGCCTTGG - Intronic
1104944640 12:132410152-132410174 CTGGTGTGGATGGTGAGCTCCGG - Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1106335500 13:28778936-28778958 GTGCTGAGCTTGGTGACCGCTGG + Intergenic
1112033207 13:95475498-95475520 CAGCTGTGCTGACTGAGCACTGG + Intronic
1112106393 13:96244966-96244988 ATGCTGTGCCTTCTGAGCACAGG - Intronic
1112265532 13:97920071-97920093 CTGCTGGCCTTGGTGTACACAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114476575 14:22999255-22999277 GTGATGTGCTAGGAGAGCACAGG - Exonic
1115885917 14:37971329-37971351 CTGCTGGGCGTGGTGGGCAGTGG + Intronic
1117557518 14:56901291-56901313 CTGCTGCGATTGGTGAGCTAGGG + Intergenic
1122100309 14:99403244-99403266 CTGCTGTGCTCGGCGGTCACTGG - Intronic
1122116023 14:99527687-99527709 CTGCTGAGCTGGGTGGGCACTGG - Intronic
1122538346 14:102481901-102481923 CTGCAGTGCTTCCTGGGCACGGG + Intronic
1123123117 14:105927201-105927223 CTGCAGTGCTGGCTGAGGACAGG - Intronic
1124365499 15:29068480-29068502 CTGCTTAGCTTGGTCAGCGCAGG + Intronic
1124477019 15:30044542-30044564 GCCCTGTGCTTGGTGAGCCCGGG + Intergenic
1125172523 15:36781896-36781918 CTTCTGAGATTGGTGAGGACAGG - Intronic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1128510043 15:68307727-68307749 CTGCTGGGCTAGGGGAGCAGGGG + Intronic
1130425384 15:83792741-83792763 CTGGTGTGCATGGTGTGCAGTGG - Intronic
1132379894 15:101359040-101359062 CTGCTGTGTGTGGGGAGGACGGG - Intronic
1132598559 16:763945-763967 CTGTGGGGCTTGGGGAGCACTGG + Intronic
1132643307 16:987784-987806 CTGCTGTTCTTGGTAGGCCCTGG - Intergenic
1134821274 16:17249289-17249311 TTGCTTTGCTTGGTGCACACAGG + Intronic
1136075169 16:27812200-27812222 GTGCTGGGCTTGGGGACCACAGG + Intronic
1136273781 16:29165942-29165964 CTGCTGTGTGAGTTGAGCACTGG + Intergenic
1136638860 16:31544829-31544851 CTGCTGTGCCTGGTTTCCACTGG - Intergenic
1136676613 16:31914140-31914162 CTGCTGTGATAGGGCAGCACTGG + Intronic
1136984311 16:35084784-35084806 GGGGGGTGCTTGGTGAGCACAGG - Intergenic
1138413199 16:56855558-56855580 CTGGGGTGCTGGGTGACCACTGG + Intergenic
1139047330 16:63077518-63077540 CAGCTTTGCTTGGTGAGTCCAGG - Intergenic
1139372438 16:66477425-66477447 CAGCTGTGCTTGGTGAGGAGAGG + Intronic
1139562091 16:67749588-67749610 CTGCTGGGCCTGGTGAGCTTAGG - Intronic
1140730580 16:77852339-77852361 CTGCTGTGCTCCGTGAGGACGGG + Intronic
1142175583 16:88643548-88643570 CGGCTGTGCGTGGCGAGCAGTGG - Exonic
1143780787 17:9228249-9228271 CTGCTTTGCCCAGTGAGCACTGG - Intronic
1145282214 17:21476537-21476559 CTTCTGTGCTTGGAGAGCCCTGG + Intergenic
1145395224 17:22489074-22489096 CTTCTGTGCTTGGAGAGCCCTGG - Intergenic
1146006850 17:29165988-29166010 CTGCTGAGCTCGCTGAGCTCTGG + Exonic
1148579710 17:48735093-48735115 CTTCTGTGCAAGGTGAACACTGG - Intergenic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1151357672 17:73570148-73570170 CTGCTGAGCTTGGTGGACACAGG + Intronic
1151515478 17:74592216-74592238 CTCCTCTCCTTGGTGATCACAGG + Exonic
1153394872 18:4607559-4607581 CTGATGTGCTACCTGAGCACTGG - Intergenic
1156608050 18:38692193-38692215 CTACTCTGCTTCATGAGCACAGG - Intergenic
1156941920 18:42778099-42778121 CTGCTGTGCTTTTAGAGCAAAGG + Intronic
1158109408 18:53923880-53923902 CTGCTGTGCTTGCTAGGCTCAGG + Intergenic
1158872288 18:61699638-61699660 GTGCTGGGCTTGCTGAGAACAGG - Intergenic
1161628172 19:5338896-5338918 CTGCTGTCCTTGGGGTGCAGAGG - Intronic
1163892255 19:20027422-20027444 CTGCTGTGCTTGGTTTTCATGGG - Intronic
1166143607 19:40819490-40819512 CTGCTGTGAATGGTAAACACAGG + Intronic
1166183944 19:41127289-41127311 CTGCTGTGAATGGTAAACACAGG - Intronic
1166496395 19:43305974-43305996 CTGCTGTTCTGTGTCAGCACTGG + Intergenic
1166985978 19:46660312-46660334 CTGGTGTGCTTGGAGATCTCTGG - Intronic
925258991 2:2513159-2513181 CTGCTATGCTGAGGGAGCACGGG - Intergenic
927276728 2:21268291-21268313 CAGTTCTGCTCGGTGAGCACTGG + Intergenic
930873918 2:56192936-56192958 CTCCTGTGCTTGGAGTGCTCCGG - Exonic
932294978 2:70616631-70616653 CTGCCCTGCTTGGGGAGCAGTGG - Intronic
934085571 2:88506348-88506370 CTGGAGGGCTTGCTGAGCACAGG - Intergenic
934718469 2:96556713-96556735 CTGCTGTGCTGGGTGACGCCAGG + Intergenic
935457058 2:103282379-103282401 CTGCGGTGCTTGGTGGCCAGCGG + Intergenic
936118401 2:109720939-109720961 CTGCTGAGCTGGGTGAGGAGAGG - Intergenic
938207607 2:129437538-129437560 CTGCTGAGCTGCCTGAGCACAGG - Intergenic
939182199 2:138816618-138816640 TTGCTGTGCTGCCTGAGCACAGG + Intergenic
945178160 2:207064519-207064541 CTGCAATTCTTGGAGAGCACTGG - Intergenic
946738163 2:222775150-222775172 GTGCTGTGCTATGGGAGCACTGG - Intergenic
947106886 2:226676827-226676849 CTGCTGTGGCTGGGGAGGACAGG + Intergenic
947715250 2:232335963-232335985 CTGCAGTGCTGGGGGAGCCCAGG - Intronic
947750433 2:232529294-232529316 TTCCTGTGCCTGGTGAGCCCAGG + Intronic
1169020332 20:2326320-2326342 CTGCTGTGGGTGGTGACCAGTGG - Intronic
1171492341 20:25529971-25529993 CTGGTGGGCTGGGTGAGCCCTGG - Intronic
1172481541 20:35274687-35274709 CTGCTGGCCCTGGTGAGCACTGG - Exonic
1172493441 20:35360232-35360254 CTGCTATACATGGTGAGCCCTGG - Intronic
1172596219 20:36153030-36153052 CTGCTGAACCTGGTGAGCAGGGG + Intronic
1174108799 20:48183443-48183465 CTGCTCTGATTGGTCAGCTCTGG - Intergenic
1175933640 20:62505169-62505191 CTGCTGTGGTTCTTGAGCTCTGG - Intergenic
1175980738 20:62737453-62737475 CCGCTGTGCCTGATGAGCAGGGG - Intronic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176088957 20:63310489-63310511 CTGCGGGGCCTGGTGACCACAGG + Exonic
1179098729 21:38337904-38337926 CTGCTGTGCCAAGTGGGCACAGG + Intergenic
1181931450 22:26404972-26404994 TTGGTGTTCATGGTGAGCACTGG - Intergenic
1181977768 22:26743305-26743327 ATGCTGTGATTGGTCAGCCCTGG - Intergenic
1182884159 22:33759026-33759048 CTACTGGGGTTGGTGAGGACAGG + Intronic
1183954730 22:41372667-41372689 TTGCTATGCTTGGAGAGCCCGGG + Intronic
1184013431 22:41767048-41767070 CTGAGGTCCTTGGTGAGCAATGG + Intronic
1184687365 22:46102680-46102702 CTTCTGTGTTGGGTGAGCCCAGG - Intronic
950912209 3:16605987-16606009 CTGCTGTACCTGGTAATCACAGG - Intronic
952512449 3:34070889-34070911 TTACTGGGCTTGCTGAGCACTGG + Intergenic
952947381 3:38487478-38487500 CTGCTATGCTTTGTGTGCTCGGG + Exonic
954103078 3:48392953-48392975 CTGCAGTGCTTTGTGGGCAGAGG + Intronic
954544188 3:51418800-51418822 CTGCTGTGCATTCTCAGCACGGG - Exonic
955505627 3:59630357-59630379 GTGCTGTGCTGGGTAATCACAGG + Intergenic
955929261 3:64039438-64039460 CTGCTGTGCTGGGTGTTCGCAGG + Intergenic
961952187 3:130761848-130761870 CTGCTGTGATAGGACAGCACTGG - Intergenic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
962809852 3:138950528-138950550 CTGCGGTGCTTGGCTAGCAAAGG + Exonic
963543955 3:146631425-146631447 CTGATGTGATAGCTGAGCACAGG - Intergenic
967889793 3:194356902-194356924 CTGCTGTGCCTGGTGCCAACAGG - Intronic
968437752 4:602863-602885 CTGCGGTGTTAGGTGAACACAGG - Intergenic
968970911 4:3793298-3793320 CAGCTGGGCTTGGTGAGGTCTGG + Intergenic
971995159 4:33955476-33955498 CTGCTGGGCTTGGAGGGAACGGG - Intergenic
973836929 4:54819141-54819163 CATCTGTATTTGGTGAGCACTGG - Intergenic
975386231 4:73763421-73763443 CTGCTTTGCTTGCTGAGTCCAGG - Intergenic
975895954 4:79090698-79090720 CAGCTATGCTAAGTGAGCACAGG + Intergenic
976155381 4:82138818-82138840 CTGCTCTACCTGGTGACCACTGG - Intergenic
977577992 4:98694986-98695008 CTGCTGTGATTGGTGAGTGTGGG + Intergenic
977722388 4:100254708-100254730 ATGCTGTGCTGTGGGAGCACAGG - Intergenic
979103312 4:116651006-116651028 CTGGTGACCTTGGTGAGAACAGG + Intergenic
979766387 4:124469005-124469027 GAGCTGAGGTTGGTGAGCACAGG - Intergenic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
982991708 4:162284836-162284858 GTGGTGTGGATGGTGAGCACTGG - Intergenic
984757718 4:183339528-183339550 CTGCTGTGCTTGGAGAACAGAGG - Intergenic
986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG + Intergenic
993668122 5:90726486-90726508 CAGTTGTCATTGGTGAGCACGGG - Intronic
994318491 5:98361377-98361399 CCCCTCTGCTTGGTGAGGACAGG - Intergenic
997303102 5:132820632-132820654 CGGCTGGGCGTGGGGAGCACAGG - Intergenic
997530084 5:134576646-134576668 TTGCTGTGGAGGGTGAGCACTGG + Intronic
998045114 5:138980827-138980849 CTCCTGTGCTTGGTAACAACAGG + Intronic
998388534 5:141772435-141772457 TTTCTGTGCTTCCTGAGCACGGG + Intergenic
1001970676 5:175952827-175952849 CTGCTGTGCTGAGTTAGGACCGG - Intronic
1003126945 6:3363249-3363271 CTGCTGCGCCTGGTGAGGATGGG - Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003643486 6:7895337-7895359 CTGCTGTGCTGAGTGAGGCCAGG + Intronic
1005132947 6:22533064-22533086 CTTCTATGCTTGGTTAGCAAAGG - Intergenic
1005753692 6:28906607-28906629 CTGCAGTCCTTGGTGTGCAGTGG - Intronic
1006171406 6:32095475-32095497 CTGCTGCCCCTGGTGGGCACTGG + Intronic
1008013529 6:46491940-46491962 CTTCTGCGCTTGGTGGGCGCTGG + Intronic
1010284945 6:74065917-74065939 CTGCTGTGCCTGAGGAGCAGAGG + Intergenic
1011418633 6:87149976-87149998 TTGTTGTGCTTGGTGTGCTCTGG - Intergenic
1015927829 6:138328038-138328060 TTGGTGTCTTTGGTGAGCACTGG - Exonic
1016737244 6:147492668-147492690 CTGTTTTGATTGGTGACCACAGG - Intergenic
1017255660 6:152330333-152330355 CTCGTGTTCTTGGTAAGCACTGG + Exonic
1017764776 6:157597661-157597683 CTGCTGTCCTGTGTGGGCACTGG + Intronic
1017950562 6:159131703-159131725 CTGCTGTGCTTTGTAACCCCCGG + Intergenic
1018621429 6:165732864-165732886 CAGCTGTGCTTGGTGGCCAGCGG - Intronic
1020139889 7:5606412-5606434 CTGCTGTGATTGGTGCTCCCTGG + Exonic
1024786339 7:52911602-52911624 CAGCTGTGCCTGGGGGGCACAGG + Intergenic
1026450792 7:70527515-70527537 CTCCTTTTCTTGGTGGGCACAGG - Intronic
1028616466 7:92773464-92773486 CTGCTCTGCATGCTGAACACAGG + Intronic
1028623283 7:92847744-92847766 GTGATGTGCTTGGTGAGTTCAGG - Intergenic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1029413648 7:100430248-100430270 CTGCTGCGCCTGGGGACCACTGG - Exonic
1029419291 7:100464140-100464162 CTGCTGTGCTTGAAGCTCACAGG - Exonic
1041304734 8:56447092-56447114 CGGCTGTGCTTGGTGCCCACGGG - Intergenic
1042730743 8:71931458-71931480 CTTCTGTGTTTGTGGAGCACAGG + Intronic
1046176288 8:110579261-110579283 ATGCTGTGCTAGGTGTGCAATGG + Intergenic
1046949432 8:120005724-120005746 CTCCAGTTCTTAGTGAGCACAGG + Intronic
1049576697 8:143393016-143393038 CAGGTGTGCTTGGTGGGCACTGG - Intergenic
1052243817 9:26308958-26308980 CTGCTGTGCAATGTGAGCTCAGG - Intergenic
1053735202 9:41096906-41096928 GTGCTGTGTGTTGTGAGCACGGG - Intergenic
1055021760 9:71677737-71677759 AAGCTGTGCTCTGTGAGCACTGG - Intergenic
1058232558 9:102447293-102447315 CTGCTGTGACAGGGGAGCACTGG - Intergenic
1059364080 9:113771765-113771787 ATGCTGTGCTTTGTAAGCATAGG - Intergenic
1061663627 9:132147516-132147538 AGGTTGTGCTTGGTGACCACGGG - Intergenic
1062187390 9:135225145-135225167 CTGCGGTGGCTGGAGAGCACAGG - Intergenic
1062191816 9:135251742-135251764 CTGCTGTCTTGGCTGAGCACAGG - Intergenic
1062433093 9:136534793-136534815 CTGATGTGCTGGGCGTGCACAGG - Intronic
1062444086 9:136586086-136586108 CTGGTCTGCTTGGAGAGCAAGGG + Intergenic
1062583519 9:137238461-137238483 CTGCTGTCCTTGTTGGGCTCAGG + Intergenic
1203779016 EBV:90448-90470 CTGTTGTCCTTGGTTAGCCCCGG + Intergenic
1186470825 X:9820997-9821019 TTGCTGTCCTTGGTAAGCAGTGG + Intronic
1189482730 X:41405691-41405713 CAGCTGAGCCTGGTGAGCCCAGG - Intergenic
1195374318 X:104211822-104211844 CTACTGTCCTTGCTGAGCTCTGG - Intergenic
1195443203 X:104921294-104921316 CTGCTAGGCTTGGAGAGAACAGG + Intronic
1199976417 X:152897477-152897499 TTGCTGTGCCTTGTGAGCCCCGG + Intergenic
1200231716 X:154447094-154447116 CTGCTCTGCTTGGGGCCCACCGG + Intronic