ID: 1127476855

View in Genome Browser
Species Human (GRCh38)
Location 15:59342426-59342448
Sequence GAAAACATTGGGAAGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127476855_1127476858 14 Left 1127476855 15:59342426-59342448 CCTGGAGTCTTCCCAATGTTTTC 0: 1
1: 0
2: 10
3: 36
4: 227
Right 1127476858 15:59342463-59342485 TAGTTTGAAGTCTTAGATTTAGG 0: 1
1: 15
2: 45
3: 279
4: 1269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127476855 Original CRISPR GAAAACATTGGGAAGACTCC AGG (reversed) Intronic
902768961 1:18634665-18634687 GAAAACAATGGGAGGACATCTGG - Intronic
903539659 1:24089854-24089876 GAACACATTGGGAAAAGTCCTGG - Intronic
903759503 1:25687984-25688006 GAAAACATTTAGATGACTTCGGG - Intronic
904554204 1:31347520-31347542 GAAAACTGTGGGAACATTCCAGG + Intronic
907095780 1:51779454-51779476 GATAACATTGGAAAAACTTCTGG + Intronic
907791804 1:57673485-57673507 GAAAATATTAGGAGGAATCCAGG + Intronic
908063096 1:60372726-60372748 GAAAACATTTGGAAGGGGCCAGG + Intergenic
908782568 1:67704618-67704640 GAGACCCTTGGGAGGACTCCAGG - Exonic
908787020 1:67745320-67745342 GAATACATTTGGAAGAGTCCTGG + Intronic
909542549 1:76807062-76807084 GAAAAGATTTGGAAAACTCTTGG + Intergenic
915337627 1:155155687-155155709 GAAAACATTGAGGAAACTCCAGG + Intergenic
916586891 1:166156954-166156976 GTAGACTTTGGGAAGCCTCCAGG - Intronic
917058876 1:171015305-171015327 GATAACATTGGGAAGAGCTCTGG - Intronic
917230733 1:172834861-172834883 GAAAACATGAGGAAGCCTCTGGG - Intergenic
917559026 1:176125329-176125351 GAAAACATTGGGGAAACTTGGGG - Intronic
919115817 1:193279181-193279203 GAAAACACTGGGAAGAAACAAGG + Intergenic
919676838 1:200392374-200392396 GAACACAGTGGGAAGCCTCAGGG + Intergenic
920180124 1:204127307-204127329 GAAGAGGTTGAGAAGACTCCTGG + Exonic
920697329 1:208191181-208191203 ACAAACATTGGTAAGAATCCCGG + Intronic
923382240 1:233432955-233432977 GAAAACCTAGGGAAAACTCTTGG - Intergenic
924353816 1:243148228-243148250 GACAAATTTGGGAAGACTCTAGG + Intronic
1063092787 10:2882477-2882499 GACAACATTAGGAAGACCTCGGG + Intergenic
1064074480 10:12257914-12257936 GAGAACACTGGGAAGGGTCCCGG - Intergenic
1065015246 10:21456832-21456854 GAAGACAGTGTGAAGACACCAGG - Intergenic
1065024981 10:21533665-21533687 GTGAACTTTGGGAAGAGTCCAGG + Intergenic
1067650094 10:48146803-48146825 GACCACATGGGGAAGACACCAGG + Intergenic
1069050975 10:63793713-63793735 GAAAACATTGGGGAAACTCCAGG + Intergenic
1070278938 10:75034831-75034853 GAAAACAGAGAGAACACTCCCGG - Intergenic
1071734943 10:88287963-88287985 GACAAGACTGGGAAGAATCCTGG + Intronic
1071787981 10:88924391-88924413 GAAGACATTGGGAAGACAGAAGG - Intronic
1072698218 10:97620189-97620211 GAAAACATAGGGAACAGGCCAGG + Intronic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1073710541 10:106032811-106032833 GAAAACATCAGTAATACTCCAGG + Intergenic
1074298275 10:112210868-112210890 GAAAGCATTGGGAGCACTCATGG + Intronic
1075299537 10:121309466-121309488 GAAAACATTTGGAAGGATTCGGG + Intergenic
1076854503 10:133109238-133109260 GGAAAGGTGGGGAAGACTCCTGG - Intronic
1079213813 11:18488089-18488111 GAAAACATTAGGCAGAATACTGG + Intronic
1080029511 11:27646169-27646191 GAAAACACGGGGAAGAAGCCAGG + Intergenic
1081921734 11:46784442-46784464 GAAAAAATTGGGAAAACTAGAGG + Intronic
1082111144 11:48275835-48275857 AGAAGCATTGGGAAAACTCCAGG - Intergenic
1082572491 11:54760373-54760395 GAAAACATGGGGTTGGCTCCTGG + Intergenic
1085369966 11:75993172-75993194 GTAAACATTTGGAAGAAACCAGG + Intronic
1085866193 11:80296666-80296688 GAAAACATTGGGAAAACATTGGG + Intergenic
1085990496 11:81837291-81837313 GAAAACATTGGGGAAACTCTTGG - Intergenic
1087608032 11:100401103-100401125 GAAAACAGTGGAAAAGCTCCTGG - Intergenic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1089946936 11:122485541-122485563 AAAAACATTGAGGAAACTCCAGG + Intergenic
1090923680 11:131231045-131231067 AAGCACATTGGGAAGACTACAGG - Intergenic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1097570817 12:61328808-61328830 GAAAACATTAAGATGACTGCTGG - Intergenic
1097670571 12:62532169-62532191 GAAAACATTGGCACAACTCAGGG + Intronic
1098207413 12:68126658-68126680 GAAAACATTGGGGAAACTCCAGG - Intergenic
1099547445 12:84002623-84002645 GAAAACTTTGGGGAAACTCCAGG - Intergenic
1100850356 12:98703766-98703788 GAAAACAATGGAATGACTGCTGG + Intronic
1101162123 12:101988626-101988648 GAAAACATTGGGGAAACTCCAGG - Intronic
1101450266 12:104770135-104770157 GAAAACATTGGATAAAATCCTGG - Intergenic
1102882879 12:116499431-116499453 GTAAGCATTGAGAGGACTCCAGG - Intergenic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1104240885 12:126988247-126988269 GAAAACCTCTGGAAAACTCCAGG - Intergenic
1105053499 12:133077083-133077105 GAAATCTTTGGCAAGATTCCAGG + Intergenic
1106188680 13:27431007-27431029 GAAAACATTGGAAAAACTTCTGG - Intronic
1106583081 13:31034221-31034243 GAAAACACTGGAAAAACTGCAGG - Intergenic
1106593322 13:31116578-31116600 GATAACCTTGGGAACACGCCTGG - Intergenic
1109602117 13:64644588-64644610 GAAAACATGGGAAAGATTCTTGG + Intergenic
1110378057 13:74816146-74816168 GAAAACACTGGGGAAACTCCAGG + Intergenic
1110448252 13:75612612-75612634 GAAAACACTGGGGAAACTCCAGG - Intergenic
1111370648 13:87312441-87312463 GAAAAGATGAGGAAGATTCCAGG - Intergenic
1111606080 13:90541018-90541040 GAAAAAAATGGGTAGATTCCTGG + Intergenic
1112944220 13:104906484-104906506 GGAAACATTGAGGAAACTCCAGG - Intergenic
1112999727 13:105620139-105620161 GGAAGCAATGAGAAGACTCCTGG + Intergenic
1113797283 13:113065900-113065922 GAAGAGACTGGGAAGACTCGGGG + Intronic
1115408908 14:33050387-33050409 GAAGACCTAGGGAAGACTGCTGG - Intronic
1115931022 14:38494856-38494878 GAAAGCATTGGGGAAACTACAGG - Intergenic
1118497293 14:66320627-66320649 GAAAACATGGGGAAAACTTCAGG + Intergenic
1120769980 14:88368812-88368834 GAAAACATTGGGGAAACACCAGG - Intergenic
1124212585 15:27775766-27775788 GAAAACATTGTGAAGACACAGGG - Intronic
1124421955 15:29530451-29530473 AAAAACAATGAGAAAACTCCTGG - Intronic
1125022563 15:34999684-34999706 GGAAACATTTGGAAGACTTTAGG + Intergenic
1125678147 15:41513375-41513397 GAAAGCATTGGGGAGGCTGCAGG - Intronic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1127617996 15:60706384-60706406 GAGAACAATGGACAGACTCCAGG - Intronic
1130971449 15:88736842-88736864 GAAAGCATTTAGAACACTCCTGG - Intergenic
1133560677 16:6947334-6947356 GATAACATTATGAAGACACCTGG + Intronic
1138707746 16:58934975-58934997 GAAAACATTAGTAAAACTCAGGG + Intergenic
1138751065 16:59421679-59421701 GATAACATTGGAAAAACTTCTGG - Intergenic
1139465515 16:67151835-67151857 GGACAGCTTGGGAAGACTCCTGG + Intergenic
1139515391 16:67449666-67449688 CACAGCATTGGGAGGACTCCAGG - Intronic
1140219592 16:73033880-73033902 GTCAACAGTGAGAAGACTCCAGG + Intronic
1140524140 16:75608228-75608250 GAAAACAATTGGAAGCCTTCAGG - Exonic
1141361614 16:83400514-83400536 GAAAGCATTGGGGAGAACCCAGG - Intronic
1143921116 17:10331789-10331811 GAGAACATAGAGAGGACTCCAGG - Intronic
1144609969 17:16702520-16702542 CAAAACATAGGGAAGAGACCAGG - Intronic
1144902775 17:18612896-18612918 CAAAACATAGGGAAGAGACCAGG + Intergenic
1144928286 17:18833082-18833104 CAAAACATAGGGAAGAGACCAGG - Intergenic
1145129792 17:20333849-20333871 CAAAACATAGGGAAGAGACCAGG - Intergenic
1145194950 17:20884097-20884119 CAAAACATAGGGAAGAGACCAGG + Intronic
1146075919 17:29728949-29728971 GAAAACACTGGGGAAACTCCAGG + Intronic
1146253907 17:31377728-31377750 CAAAAGATTGGGAGGACTCGGGG - Intronic
1146665037 17:34694624-34694646 GAAAACATAGGGAAAAATCTTGG + Intergenic
1147542697 17:41374140-41374162 TAAAGCAATGGGGAGACTCCTGG - Intronic
1149113231 17:53060447-53060469 GAGAACATTGGGGACATTCCAGG + Intergenic
1152154503 17:78623867-78623889 GGAAACATTTGGAAGCCCCCAGG - Intergenic
1155155245 18:23152003-23152025 GAAGGCATTGAGGAGACTCCGGG + Intronic
1157081948 18:44535004-44535026 GAGAAGATGGGGAAGACTCCTGG + Intergenic
1157558691 18:48631138-48631160 GGAAAGATTGGGGAGACCCCAGG - Intronic
1157729400 18:49990621-49990643 GAAAACACTGGGAAGAGTGGGGG - Intronic
1158021326 18:52845582-52845604 GAAAACAGTGGGAGGCCTCAGGG + Intronic
1159139848 18:64380386-64380408 TAAAACATTGGAAAGAATTCAGG - Intergenic
1159456009 18:68660905-68660927 GAAAATCCTGGGAAGAGTCCAGG - Intergenic
1162120861 19:8466922-8466944 GAAAACAGTAGAAAGACTCATGG - Intronic
1164261440 19:23571461-23571483 GAACACTCTGGGAAGACTCTGGG - Intronic
1164511424 19:28900388-28900410 TAATACATGGGGAAGACTGCTGG + Intergenic
1165431361 19:35775396-35775418 GAAACCAATGAGAAGCCTCCGGG + Intronic
1166465663 19:43028162-43028184 GCATCCCTTGGGAAGACTCCAGG + Intronic
1166759680 19:45216841-45216863 GAAAACATTCCAAGGACTCCGGG + Exonic
1167501987 19:49853752-49853774 GGAAACATTTGGAAGACAGCTGG - Intronic
1167605685 19:50480404-50480426 GATAGCATTGTGAGGACTCCCGG + Intronic
926826193 2:16907283-16907305 GAATCCTTTGGGAGGACTCCAGG - Intergenic
927434561 2:23055881-23055903 GGAAACAAGGGGCAGACTCCCGG + Intergenic
928107828 2:28483595-28483617 GGTTAGATTGGGAAGACTCCTGG + Intronic
930041167 2:47125666-47125688 CAAAACATTGAGGAAACTCCAGG - Intronic
930317340 2:49813692-49813714 GAATGCAGTGGGAAGATTCCAGG - Intergenic
930445070 2:51460006-51460028 GAAAAAATAGGGAAGGCTTCAGG - Intergenic
931179680 2:59886839-59886861 CAAGCCATTGGGAAGACTCTGGG + Intergenic
931687921 2:64810442-64810464 GAAAACGTTGAGAAGACCTCAGG + Intergenic
934149628 2:89133818-89133840 TAAAACTGTGGGCAGACTCCAGG - Intergenic
934217667 2:90048209-90048231 TAAAACTGTGGGCAGACTCCAGG + Intergenic
937662965 2:124452019-124452041 GAACCCATTGAGAAGTCTCCTGG + Intronic
938169847 2:129065501-129065523 AATAAAAATGGGAAGACTCCAGG + Intergenic
939003852 2:136764792-136764814 GGAAACATTGTGGTGACTCCGGG - Intergenic
939117621 2:138078456-138078478 GAAACAATGGGGAAGACTCATGG + Intergenic
939263625 2:139842760-139842782 GAAAACATTGGGTATGCTCCAGG + Intergenic
940425804 2:153530942-153530964 GAAAACATTGGAGAAACTTCAGG + Intergenic
941047400 2:160691957-160691979 GAAAACATTGAGGAAACTCTAGG - Intergenic
941780262 2:169436820-169436842 GAAAACATCGGGAAAACTCCAGG + Intergenic
942271830 2:174283141-174283163 GAAAGCATTGGGCTGATTCCAGG + Intergenic
943666774 2:190617263-190617285 AAAAGCTTTGGGAAGACTCTTGG - Intergenic
943718513 2:191178583-191178605 GAACACACTGGGGAGATTCCAGG - Intergenic
944361184 2:198859165-198859187 AAAAATATTGGGGAAACTCCAGG + Intergenic
945048379 2:205801305-205801327 CAACACAATGGGAAGAGTCCTGG + Intergenic
946693879 2:222333098-222333120 GAATACTGTGGGAAGTCTCCAGG - Intergenic
947021475 2:225681925-225681947 TAAGACATTTGGAAGACCCCCGG + Intergenic
948850940 2:240705228-240705250 GAAAACATTGGAAAAAATCTGGG - Intergenic
1168829299 20:835851-835873 GAGGAGATTGGGAAGGCTCCAGG - Intronic
1170414364 20:16124305-16124327 GAACACAGTGGGAGGACCCCAGG + Intergenic
1172203349 20:33142895-33142917 GGAAACATTGGGGAAACTCCAGG - Intergenic
1172494452 20:35369103-35369125 GAGAAAATTGGAAAGGCTCCTGG - Intronic
1173127347 20:40351363-40351385 GAAAGCATTGGGGAAACTCCAGG + Intergenic
1176983349 21:15408179-15408201 GAAGACATTGTGAAGACTCAGGG + Intergenic
1178538084 21:33426901-33426923 GAAAACATTGAGGTGACCCCAGG + Exonic
1178890245 21:36514898-36514920 GATAACAGTGGGAAGACCCGGGG - Intronic
1180954362 22:19735030-19735052 GGAAAGACTGGGAGGACTCCAGG - Intergenic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181612746 22:24029615-24029637 GGACACATTGGGAAGACTGTGGG - Intronic
1181914473 22:26268557-26268579 GAATTCATTGGGATGCCTCCGGG - Intronic
1182806017 22:33071173-33071195 AAAAACCTTTGGAAGACTCTGGG - Intergenic
1184236569 22:43186345-43186367 GAAAAGATTGAGAAGCCTCTAGG - Intronic
1184387126 22:44182611-44182633 GAAAACACTGAGAAGACCCAGGG + Intronic
1184987251 22:48144346-48144368 GAGAACATTGGCGAGACTCCTGG + Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951172378 3:19556840-19556862 GAAATCATTGAGAAGAGTTCAGG - Intergenic
951309878 3:21111757-21111779 CAAAACATTGGGGAAACTCCAGG - Intergenic
951694978 3:25437032-25437054 GAAAACATATGGAAGTCACCAGG + Intronic
954575792 3:51675431-51675453 GCACACATTGGGTAGACTGCAGG - Intronic
954932485 3:54296146-54296168 GATGACATTTGGAAGACGCCTGG + Intronic
956063840 3:65376098-65376120 CAAAACATTGGCAATACTCAGGG + Intronic
956749492 3:72334922-72334944 GAAGACAGTGAGAAGACACCAGG + Intergenic
958100746 3:89006297-89006319 GAAAACGCTGGGGAAACTCCAGG - Intergenic
958657423 3:97020134-97020156 GAAAACACTAGGAAAGCTCCTGG - Intronic
962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG + Intronic
966133278 3:176668752-176668774 GAAAACACTGGGGAAACTCCAGG - Intergenic
966139968 3:176745798-176745820 GAAAAGATTGGGAAGAATACCGG - Intergenic
966625365 3:182009831-182009853 GAACCCATTGCGAAGAGTCCTGG - Intergenic
967242974 3:187459297-187459319 GAACACATAGGAAAAACTCCTGG - Intergenic
969189353 4:5504569-5504591 TAAAATTTTGGGAAGATTCCAGG - Intergenic
970759336 4:19465324-19465346 GAAAACAAAGGGAAGGCTTCAGG - Intergenic
972022893 4:34336986-34337008 GAAAACCTAGGGAAAACTTCTGG - Intergenic
973227622 4:47803759-47803781 GAAAACATTGGGGAAACTTTAGG + Intronic
974054540 4:56972261-56972283 GAAAACATTCTGAAGAGGCCTGG + Intronic
974273652 4:59686970-59686992 GAAAACAGTGTGAAAACTTCTGG + Intergenic
974301424 4:60072397-60072419 GAAAACATTGGGGAAACTGTAGG + Intergenic
975179558 4:71328905-71328927 GAAAACATTGGGGAAACTCCAGG - Intronic
975425131 4:74216472-74216494 GGAAACATTGGAATGACACCAGG + Intronic
976567069 4:86563372-86563394 GAAATCATTGTGAAAATTCCAGG + Intronic
977860067 4:101946680-101946702 TAAAACATAGGGACTACTCCTGG + Intronic
978727996 4:111992978-111993000 GAAAACTTTGGCAAGACCCAGGG + Intergenic
979247991 4:118531402-118531424 GACAAATTTGGGAAGACTCCAGG - Intergenic
981387225 4:144146160-144146182 GAACAGATTGAGAAGTCTCCTGG + Intergenic
981788226 4:148504830-148504852 GAGAACATTTGGGAGACCCCTGG - Intergenic
982198348 4:152937134-152937156 AAAAACAGAGGGGAGACTCCTGG - Intronic
983027981 4:162760419-162760441 GACTACAATGTGAAGACTCCAGG - Intergenic
984088342 4:175339826-175339848 GACAAAATAGGGAAGACTGCAGG - Intergenic
984657303 4:182332337-182332359 GAAAACATTGTGAAGAAATCAGG + Intronic
986016334 5:3760809-3760831 GAATCCAGAGGGAAGACTCCAGG + Intergenic
986751191 5:10789394-10789416 GAAAACATTGAAAAGAGTCCAGG + Intergenic
986765825 5:10925249-10925271 GCAAATATTGGGAAGATTTCAGG - Intergenic
991517883 5:67459559-67459581 GAGAATATTGGGCAGAATCCTGG - Intergenic
993786776 5:92148612-92148634 GAAATCATTTGGAAAACTCCAGG - Intergenic
996362379 5:122664202-122664224 GACCACACTGGGAAGTCTCCAGG - Intergenic
996915087 5:128702899-128702921 GAAAAGATTTGGAAAACTCTTGG + Intronic
997114429 5:131111346-131111368 GAAAACGTTTTGAAAACTCCAGG + Intergenic
997597120 5:135114487-135114509 GACAACAGAGGGAAGGCTCCAGG + Intronic
998151077 5:139757867-139757889 GAAACCATTTGTAAGACACCAGG - Intergenic
998624918 5:143835532-143835554 AAAAGCATTTGGAAAACTCCAGG - Intergenic
998737294 5:145156977-145156999 GAACACATTTGAAAGATTCCAGG - Intergenic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1000242717 5:159423507-159423529 GACAGCATTGATAAGACTCCTGG + Intergenic
1001024740 5:168214555-168214577 GATAAAATTAGGAAAACTCCAGG + Intronic
1002814005 6:661211-661233 GAAAACATGGGGAATAATCATGG + Intronic
1003768249 6:9265996-9266018 GAAAACCTTGAGAAGACTCAAGG - Intergenic
1003920201 6:10825715-10825737 TAAAAAATGGGGAAGAGTCCAGG - Intronic
1004184581 6:13411123-13411145 AAAAACAGAAGGAAGACTCCAGG + Intronic
1004470766 6:15927100-15927122 GTAAACAGTGGCAAGACTCAAGG + Intergenic
1005131796 6:22517134-22517156 GAAAACCTTGGGAAAACTGAAGG - Intergenic
1006593614 6:35176490-35176512 GGAAGTATTGGCAAGACTCCTGG + Intergenic
1008100401 6:47384626-47384648 GAAAACATTGGGGAAACTCCAGG - Intergenic
1009997050 6:70907417-70907439 GAGAGCATTGGAAAGACTTCAGG + Intronic
1012330894 6:97985386-97985408 GAAAACATAGGGAAAAGTCTTGG + Intergenic
1013595557 6:111657513-111657535 GTAAACATTCTTAAGACTCCCGG + Intergenic
1014830531 6:126098049-126098071 AAAAACAGTGGGGAAACTCCAGG - Intergenic
1015806869 6:137118699-137118721 GAACACATTGAGAAAACACCAGG + Intergenic
1016252763 6:142065861-142065883 GAAAACATTGGGGAAACTCTAGG - Intronic
1017898767 6:158703172-158703194 AAAAAAATTGGGATGACACCTGG + Intronic
1018104062 6:160466470-160466492 GAAAATACTGGAAAGACTTCAGG - Intergenic
1018112346 6:160547697-160547719 GAAAATACTGGAAAGACTTCAGG - Intronic
1022397740 7:30005740-30005762 AAAAACAGTTGGAAGACTCCGGG - Intergenic
1022549159 7:31220728-31220750 GAAACCCTTGGGAAGACACAGGG - Intergenic
1022751394 7:33230336-33230358 GAACACAGTGGGAAAGCTCCTGG - Intronic
1025939581 7:66065280-66065302 GAAAACAATGTGAAGACACAGGG + Intergenic
1027996541 7:85432883-85432905 GAAAACATTGGGGAAACTCCAGG + Intergenic
1028231157 7:88307530-88307552 GAGATCATTGGGAAGACTCTGGG - Intergenic
1028809405 7:95067343-95067365 TAAAACAGTCAGAAGACTCCAGG + Intronic
1029863438 7:103600403-103600425 GAAAAAACAGGGAAGACTCCTGG - Intronic
1030479014 7:110078436-110078458 TAAAACATTGGGGAAACTCCAGG - Intergenic
1035082183 7:156225702-156225724 GAAAACATTGGTGAGACACATGG + Intergenic
1036117716 8:5977329-5977351 GAAAACACTGGGCATCCTCCTGG - Intergenic
1036191308 8:6672947-6672969 GAAAACAGGGGAAACACTCCAGG + Intergenic
1039050931 8:33492492-33492514 GAAAACACTGAGAAAACTCCAGG - Intronic
1041107092 8:54454350-54454372 GCAAACCCTGGGAAAACTCCAGG - Intergenic
1041647462 8:60268017-60268039 GTACACAGTGGGTAGACTCCTGG - Intronic
1041693994 8:60716241-60716263 GCTAACATTGGAAAGACTGCAGG - Intronic
1042302349 8:67298623-67298645 GAAAAACTTTGGAAGACTCTAGG + Intronic
1042359435 8:67866139-67866161 GAAAACCCTGGTAAGATTCCAGG - Intergenic
1042449863 8:68931922-68931944 GAGAACATGGGGAATACTCCAGG - Intergenic
1043133651 8:76493123-76493145 TAAAACATTGGGGAAATTCCAGG - Intergenic
1043230406 8:77793253-77793275 GAAGACAATGGGAAAACTTCAGG + Intergenic
1044132531 8:88542862-88542884 GAAAACCTTGGGAAGAGTCTTGG + Intergenic
1044717384 8:95112983-95113005 GCAGATATTGGCAAGACTCCTGG + Intronic
1045183007 8:99806390-99806412 GAAAACATTGGGAAGCAGCTGGG - Intronic
1046175215 8:110566691-110566713 AAAAACACTGGAAAGACTCAAGG + Intergenic
1047230536 8:122994558-122994580 GAAAGCATGGGGATGACTCAGGG + Intergenic
1047683446 8:127278460-127278482 GAAAACCTTGAGGAGAGTCCCGG + Intergenic
1048550951 8:135433240-135433262 GAAAACTTTGGGAAACTTCCAGG + Intergenic
1052992158 9:34524921-34524943 GAAAAGTCTGGGATGACTCCCGG + Intergenic
1055911909 9:81363034-81363056 GAAGAGTTTGGGATGACTCCAGG + Intergenic
1056178363 9:84057756-84057778 GAAATCTTTTGGAAGGCTCCTGG - Intergenic
1056850735 9:90081643-90081665 GAATCCTTTGGGCAGACTCCAGG - Intergenic
1057015231 9:91645198-91645220 GAAAACACTGGGAAGCCATCCGG + Intronic
1060241624 9:121908763-121908785 GAAGACAATGTGAAGACTCAGGG - Intronic
1060714024 9:125904258-125904280 GAAAAATCTGGGATGACTCCAGG - Intronic
1187067963 X:15859212-15859234 GAAAATATTGCGAAGAGCCCTGG - Intergenic
1187149753 X:16670619-16670641 AGGAACATTGGGAAAACTCCAGG - Exonic
1187610253 X:20935316-20935338 GAAAACATTGGGGAAACTCCAGG - Intergenic
1189171468 X:38913708-38913730 GAGCACGTTGGGAAGGCTCCTGG + Intergenic
1190750354 X:53356739-53356761 GAAGACATTGCAAAGACACCTGG + Intergenic
1192552452 X:72065096-72065118 GAAAAATTTGAGAAGACTCTTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1196362228 X:114875496-114875518 AAAAACATAGGGAAAACTCCTGG - Intronic
1197833345 X:130668916-130668938 GAAAGCATTGGTAAGACGCCAGG - Intronic
1199371019 X:147048078-147048100 GAAAACATTGGGGAAACTCCAGG + Intergenic
1199474928 X:148234490-148234512 GAAAACATCGGGGAAACTCCAGG + Intergenic
1199843841 X:151676461-151676483 GAAAACTTTGAGCAGACTCTTGG - Exonic
1200357138 X:155563547-155563569 GAAAGGATGGGGAAGACTGCTGG + Intronic