ID: 1127483173

View in Genome Browser
Species Human (GRCh38)
Location 15:59395873-59395895
Sequence TTTCCCCCAAATCCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 210}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127483170_1127483173 7 Left 1127483170 15:59395843-59395865 CCTTTCTCCTAGTCAGCCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483172_1127483173 -9 Left 1127483172 15:59395859-59395881 CCTGTGCGATATAATTTCCCCCA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483169_1127483173 8 Left 1127483169 15:59395842-59395864 CCCTTTCTCCTAGTCAGCCTGTG 0: 1
1: 0
2: 0
3: 32
4: 244
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483166_1127483173 13 Left 1127483166 15:59395837-59395859 CCTCCCCCTTTCTCCTAGTCAGC 0: 1
1: 0
2: 0
3: 22
4: 290
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483171_1127483173 0 Left 1127483171 15:59395850-59395872 CCTAGTCAGCCTGTGCGATATAA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483164_1127483173 17 Left 1127483164 15:59395833-59395855 CCACCCTCCCCCTTTCTCCTAGT 0: 1
1: 1
2: 5
3: 82
4: 890
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483167_1127483173 10 Left 1127483167 15:59395840-59395862 CCCCCTTTCTCCTAGTCAGCCTG 0: 1
1: 0
2: 3
3: 26
4: 283
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483168_1127483173 9 Left 1127483168 15:59395841-59395863 CCCCTTTCTCCTAGTCAGCCTGT 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1127483165_1127483173 14 Left 1127483165 15:59395836-59395858 CCCTCCCCCTTTCTCCTAGTCAG 0: 1
1: 0
2: 3
3: 45
4: 407
Right 1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127483173 Original CRISPR TTTCCCCCAAATCCAAAGAA AGG Intronic
900330093 1:2129866-2129888 TTACCCCCAAATAAAAAGGATGG + Intronic
900351282 1:2235922-2235944 TTTCCCCCCAAACAAAAGACAGG - Intronic
900763632 1:4488957-4488979 TTTACCCCAAGTCCAGAGTAGGG - Intergenic
901833966 1:11911730-11911752 CTTCCCTGAAAACCAAAGAACGG - Intergenic
903135780 1:21308427-21308449 TTACTCCCAATTCCAGAGAAGGG - Intronic
903770254 1:25759321-25759343 CTGACCTCAAATCCAAAGAAGGG + Intronic
904469079 1:30724727-30724749 CTTGACCCAAATGCAAAGAAGGG - Intergenic
905351919 1:37353014-37353036 TATCCCCCAACTCCAATGAGTGG + Intergenic
907117131 1:51978791-51978813 TTTTCCCCAAGGGCAAAGAAAGG + Intronic
909475256 1:76074737-76074759 ATTCCCGCAGATCCAAATAAGGG - Exonic
913470717 1:119182731-119182753 TTTCCTCCAATTCTAAGGAAGGG + Intergenic
916763318 1:167836377-167836399 TTTCTCCCAAAGCCAGAAAATGG + Exonic
918269483 1:182883345-182883367 TTTTCACCAAATACAAAGAAGGG - Exonic
918299584 1:183190609-183190631 CTTCCCCCACATTCAAAGAAAGG + Intronic
918755031 1:188329434-188329456 ATACCTACAAATCCAAAGAATGG - Intergenic
919110412 1:193212079-193212101 CCTCCCCCAAATCAGAAGAAAGG + Exonic
919864709 1:201771904-201771926 ATTCCCCCAACCCCAAAGCAAGG + Intronic
923298107 1:232614548-232614570 CTGCCCCCAAATCAAATGAAAGG + Intergenic
924456473 1:244222853-244222875 TTTCCCCCAAAGCCGCTGAAAGG + Intergenic
1063696417 10:8339632-8339654 TCTCCCTCACCTCCAAAGAAAGG - Intergenic
1064889034 10:20147956-20147978 TTTCCTCCAAATGTCAAGAAAGG + Intronic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1070719595 10:78746920-78746942 TTCCAACCAGATCCAAAGAAGGG + Intergenic
1073253317 10:102134941-102134963 TTCCCCCGAAAACCAAAGATGGG + Intronic
1074565086 10:114570312-114570334 TTACCCCCAAATAAAAAGAGTGG - Intronic
1074616609 10:115075362-115075384 TTCCCCCCAACCCCAAAGAATGG + Intergenic
1079830084 11:25253792-25253814 TTTCCAGTAAATCCAGAGAAAGG - Intergenic
1081916019 11:46730761-46730783 ATTCCCACACATCCACAGAATGG - Intronic
1082896624 11:58198307-58198329 TATCCCCCAAATTACAAGAATGG - Intergenic
1083414944 11:62519463-62519485 TTTGCCCCAAATCCAAACTTGGG + Exonic
1085962854 11:81482937-81482959 TTTCCACTAAATCAAAGGAAGGG + Intergenic
1087096591 11:94325088-94325110 TTTTATCCAAATCCAACGAAGGG - Intergenic
1088735940 11:112727739-112727761 TTACCCCCACCTCCAAAGAAGGG - Intergenic
1089672037 11:120063293-120063315 TTGCCCCGAAAGACAAAGAATGG + Intergenic
1089869067 11:121656437-121656459 TTTATCCCAAAACGAAAGAAGGG + Intergenic
1089987008 11:122824231-122824253 TCTCCCCCAAGTCCAGAGAGGGG - Intergenic
1090199483 11:124844050-124844072 ATACCCTCAAATCCAGAGAAGGG + Intergenic
1090254102 11:125271078-125271100 TTCCCTCCAAATCCACAGACAGG - Intronic
1090427879 11:126622335-126622357 ATGACCCCAAATCCAGAGAATGG - Intronic
1090442626 11:126736990-126737012 TTTCCCTGAAATCTAAATAAGGG - Intronic
1092643649 12:10545439-10545461 TTTTTCCCAAATCCAGAGAAAGG + Intergenic
1094325714 12:29236328-29236350 TTACACCCTAAGCCAAAGAAGGG + Intronic
1094544690 12:31393491-31393513 TGTCCACCAAACCCAAGGAATGG + Intronic
1095365404 12:41398205-41398227 TTTCCCCCAGATCAGAAGACTGG + Intronic
1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG + Intergenic
1098582921 12:72122006-72122028 TTTACCACAAAGCCAAAGACAGG - Intronic
1099177103 12:79434923-79434945 TTACCCCCAATTCCAAAGGTAGG + Intronic
1099362570 12:81723487-81723509 TTTCCCCCCAAACCACAGTATGG - Intronic
1101462403 12:104910229-104910251 TTTCCCCAAGATCAAAAGATGGG + Intronic
1103297781 12:119902999-119903021 TTTCCCCCCACTCCAAAGCTGGG - Intergenic
1104260809 12:127180401-127180423 ATTTCTCCAAATCCACAGAATGG - Intergenic
1107538337 13:41359101-41359123 TTTAACCCATATCCTAAGAATGG + Intronic
1107930476 13:45302957-45302979 TGTCCCCCAAATCTAGAGGAAGG - Intergenic
1108396405 13:49996091-49996113 TTTCCCCCAAAGGCAAAAACAGG + Intronic
1109369904 13:61410137-61410159 TTTAATCCAAAACCAAAGAAAGG + Exonic
1110569329 13:76987965-76987987 TTTTCACCAAATGCAAAGAAGGG - Intergenic
1110569624 13:76990372-76990394 TTTTCACCAAATACAAAGAAGGG - Intergenic
1111468677 13:88648209-88648231 TCTCCCTAGAATCCAAAGAATGG + Intergenic
1111698418 13:91655731-91655753 TTTCCCCCAAAGTCAAACATAGG - Intronic
1112108489 13:96268162-96268184 TTTCCCCAAAATTCATAGATTGG - Intronic
1114628652 14:24145983-24146005 TTTCCTCCACATCAAAAGACGGG + Intronic
1115734910 14:36315759-36315781 TTTCCCACAAAGTCAATGAATGG + Intronic
1116024966 14:39504053-39504075 TTTACCGCACATACAAAGAAGGG - Intergenic
1116258578 14:42589951-42589973 TTTCTCCTAAGCCCAAAGAATGG + Intergenic
1117031998 14:51682318-51682340 TTTCTCTCCAATCCAAAAAAAGG - Intronic
1117183169 14:53213241-53213263 TATCCCCCAAATCAGAGGAAAGG + Intergenic
1118498194 14:66329860-66329882 TTTTCTCCAAAGCAAAAGAATGG + Intergenic
1118752285 14:68816171-68816193 TTTGCCCCATATTCAAAGAGCGG - Intergenic
1120991593 14:90382445-90382467 TTTCACCCATATCCACTGAAGGG + Intergenic
1121040511 14:90742695-90742717 TTTCCCCAAAATCAAAGAAAAGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123429923 15:20205742-20205764 TTTCTACCAAATCCAAATCATGG + Intergenic
1123632888 15:22274464-22274486 TTTCCCCCAACCCCTAAGAGTGG + Intergenic
1123993591 15:25702929-25702951 TGTCCCCCAGATCCATAGGAGGG + Intronic
1125457681 15:39877374-39877396 ATTCCCCCAAATCCAAATGTAGG + Intronic
1125522178 15:40354450-40354472 CTTCCCCCAAATGAAAAGAAGGG + Intronic
1126645231 15:50869008-50869030 ATACTCCCAAATCCAAAGATGGG - Intergenic
1127483173 15:59395873-59395895 TTTCCCCCAAATCCAAAGAAAGG + Intronic
1127781519 15:62320555-62320577 TTTCAGCCAAATCCAAATCATGG + Intergenic
1131483342 15:92800454-92800476 TTCCCCCAAAACCCAAAAAATGG - Intronic
1131984606 15:98029411-98029433 TTTCCCACAGATCCAAAGAAGGG - Intergenic
1132220120 15:100099084-100099106 TTTCCTCCAGCCCCAAAGAAGGG + Intronic
1133413267 16:5586000-5586022 CTTCCCCTAAATCCAACGACTGG + Intergenic
1134434433 16:14242753-14242775 TTTCTCCCAAATCAATAGAGGGG - Intronic
1136502964 16:30682853-30682875 TTTCTCCCATATGGAAAGAAAGG + Intergenic
1137321110 16:47383602-47383624 TTTCCTCCAAATGAAAAGACTGG + Intronic
1140935493 16:79666003-79666025 TTTCCCCCAAAGCCAACCAGAGG + Intergenic
1141684748 16:85563798-85563820 AGACCCCCAAATCCAGAGAAGGG - Intergenic
1143806591 17:9433608-9433630 TTTCCCCCACATACAAAAAATGG - Intronic
1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG + Intronic
1147955067 17:44128453-44128475 TTTCCCCCAAATATGAGGAAAGG - Intergenic
1151037806 17:70821574-70821596 TTTCCACCAAAGCCAAATAATGG + Intergenic
1155102774 18:22629298-22629320 TTTCCCTCAGATCGAACGAATGG + Intergenic
1156222831 18:35070874-35070896 TTTCCCACAAATGAAAAGAAGGG - Intronic
1159366995 18:67479411-67479433 TTTCCACAAAATCCACAAAAAGG + Intergenic
1159824628 18:73191692-73191714 TTTTGCATAAATCCAAAGAAAGG + Intronic
1163400334 19:17088289-17088311 TGGGCCCCAAATCCAAAGACTGG - Intronic
1163850003 19:19657331-19657353 TTTACCTGAAATACAAAGAAGGG + Exonic
1164173243 19:22745970-22745992 TTTCCTCCAATTCTAAGGAAGGG - Intergenic
1165183239 19:33991257-33991279 TTTCCATCAAAACCACAGAAGGG + Intergenic
1168672429 19:58250782-58250804 TTTTCCCCAAGGCCAAAGATTGG + Intronic
926640773 2:15234169-15234191 TTTCCCACTACTACAAAGAATGG + Intronic
927766807 2:25817844-25817866 ATGCCCACAAATACAAAGAAGGG + Intronic
928270032 2:29847673-29847695 TTTCCTCTGAAGCCAAAGAATGG + Intronic
928454678 2:31408728-31408750 TTTCCCCCAAAAATTAAGAATGG + Intronic
930026194 2:47030509-47030531 TTCTCCCCAAAGCTAAAGAAAGG + Intronic
930741007 2:54832486-54832508 TGTGCCCCAAATCCAAAGTGAGG + Intronic
932090348 2:68800370-68800392 TTTCCAGCAAATCTAAGGAAGGG + Intronic
935590053 2:104838688-104838710 TTTACCCCAAATCTAAACAAAGG - Intergenic
939790272 2:146564336-146564358 TGTCCCTCAAATGCAAACAAAGG + Intergenic
942080278 2:172393927-172393949 TTTCTCTCACAGCCAAAGAAGGG - Intergenic
943834508 2:192501870-192501892 TTAGCCCCAAATCAAAAGACAGG + Intergenic
943836595 2:192521897-192521919 TCTCCCTGAAATCCTAAGAAAGG + Intergenic
948120832 2:235529198-235529220 TTTCCACCATATTCACAGAAAGG - Intronic
948308325 2:236966690-236966712 TTTTCCCCAAAACCAGTGAATGG - Intergenic
948314592 2:237017692-237017714 TTTCCCAGAAAACCAAATAAGGG + Intergenic
1170763297 20:19270612-19270634 CATCCACCAAATCCCAAGAATGG - Intronic
1171502283 20:25603314-25603336 CTTCACCCAAACCCAGAGAATGG + Intergenic
1172902043 20:38342462-38342484 TTTCCCCCAAATGCAGATGAGGG - Intergenic
1173743954 20:45422129-45422151 TCTCCCCCTACACCAAAGAAAGG - Intronic
1174688246 20:52476354-52476376 TTCCCACCAAATCCAAGAAATGG - Intergenic
1175718360 20:61270358-61270380 CTTCCCTCAGATACAAAGAAGGG + Intronic
1177994041 21:28073445-28073467 TTTTCCCCAAATTAAAAAAATGG - Intergenic
1178134913 21:29616011-29616033 TTTGCCCCAATTCCCAACAAGGG + Intronic
1178811957 21:35892541-35892563 TTTTCCCCCACTACAAAGAAAGG + Intronic
1179087981 21:38237366-38237388 TTCCCACCAATTCCAAAGGAGGG + Intronic
1182936580 22:34228305-34228327 TTGGCCCCAAATCCAATGACTGG - Intergenic
951190991 3:19771415-19771437 CTTCCCCCAGATCCACAGTACGG + Intergenic
952239802 3:31519369-31519391 TCACCTCCAAATCCAAAGATTGG - Intergenic
952557950 3:34555318-34555340 TTTCTCCCAAAACCAAAAATGGG - Intergenic
954868498 3:53749538-53749560 TTTCCCCCATACCCAGAGAAGGG + Intronic
955102182 3:55861007-55861029 TTTCCCCCAAATAGAAAGGTAGG + Intronic
955123743 3:56088447-56088469 TTCATCCCAAATCCAAAGAAGGG + Intronic
955561920 3:60200652-60200674 TTTCCCCCAAAAGCAACAAAGGG - Intronic
957470309 3:80650373-80650395 TTTACCCCACATCCACAGATAGG - Intergenic
959336725 3:105076554-105076576 TACCCCCTAAATCCAAAAAATGG + Intergenic
960756968 3:121025022-121025044 ATTCCCCAAATTCCAAAGCAAGG + Intronic
961924497 3:130463366-130463388 TTTCCCACAAATGCCATGAAAGG + Intronic
962036928 3:131661956-131661978 ATTCCCCCAAACCCATAGAAAGG - Intronic
965586391 3:170322087-170322109 TTTCTCTCAAATCCACAAAATGG - Intergenic
966196944 3:177323234-177323256 TTTCCCACAAATACAAAAACAGG - Intergenic
966506511 3:180708443-180708465 GTTCTCCCAAATCCCAAGTAAGG - Intronic
969644740 4:8421202-8421224 TTTCCTCCAATTCTAAGGAAGGG - Intronic
972203207 4:36740619-36740641 TTTCCCCAAAATCAATAGGAAGG - Intergenic
972407532 4:38761279-38761301 CTTCCCCCAAAACCAAAGTCAGG + Intergenic
972676786 4:41267657-41267679 TTTTCCTCAAATCTAAAGATTGG - Intronic
974698179 4:65401762-65401784 TTTCTGCCAAATCCAAAGCTTGG - Intronic
975249043 4:72155909-72155931 TTTCCCACACATTCAAAGACAGG - Intergenic
977823678 4:101504909-101504931 TCTCCCCTAAACCCAAAGAAAGG - Intronic
978736098 4:112086309-112086331 TTTCCCTTGAGTCCAAAGAAAGG + Intergenic
978927405 4:114264669-114264691 TTTTGCCTAAATCCAAAGAGAGG - Intergenic
979153148 4:117345641-117345663 TTTCTCCCAAGTCAAATGAAGGG - Intergenic
979808261 4:125002332-125002354 TTTCCCCCACAGCCAGAGCATGG + Intergenic
980175709 4:129341346-129341368 TTATCCCCACATCCAAACAACGG - Intergenic
980812794 4:137904597-137904619 TTTCCCCCAAATCCTCACAAGGG + Intergenic
981135103 4:141201843-141201865 TTTCCCCCAAATCCATATGTTGG + Intronic
981321352 4:143395807-143395829 TTACCCCCAAGTCCTTAGAAAGG - Intronic
981799913 4:148643712-148643734 TTTCCCCCAAATTACAACAAAGG + Intergenic
982981523 4:162142161-162142183 TTTGCCCCAACTCCAAAGCCAGG - Intronic
982990389 4:162266216-162266238 TTTCCACCAAATCTAAAGCTAGG - Intergenic
986541762 5:8851825-8851847 TTTCCTCCAAAAACAAAAAAAGG - Intergenic
986784625 5:11102907-11102929 TTTAAAGCAAATCCAAAGAAAGG - Intronic
988041570 5:25894763-25894785 ATTCCCCCAAATCGACAGATTGG + Intergenic
990314187 5:54568532-54568554 CTTCCCCCATTTCCAAAGGAAGG + Intergenic
990637634 5:57747122-57747144 TTTGCCCCAAATGCAGAGTAGGG - Intergenic
991047153 5:62234697-62234719 TTTCTACCAAATCCAAATCATGG + Intergenic
992391264 5:76332880-76332902 TTGCCCCTAAGTCCAAGGAAGGG + Intronic
992658287 5:78932092-78932114 TTTCACCCAATTCCAAAAGATGG + Intronic
992769147 5:80030979-80031001 TTTCCCCCACTTGCGAAGAATGG + Intronic
993625132 5:90214917-90214939 TTTCCCCCAAAATCAAGGATGGG + Intergenic
1002259045 5:177981734-177981756 TATCCCCCAAATAGAATGAATGG + Intergenic
1002855087 6:1029166-1029188 ATGCCCCCAAATCTAAGGAAAGG + Intergenic
1004547158 6:16608966-16608988 TTTCCCACAAATATAAAGATGGG + Intronic
1005085140 6:21998588-21998610 TTTCCTCAAAATCCCAAGCAAGG - Intergenic
1007247218 6:40471277-40471299 TTTTCCCAAAATCCAAACCATGG + Intronic
1007688038 6:43678974-43678996 TTTCCCCCAAAAGCCAAGGAGGG - Intronic
1011254306 6:85405394-85405416 TTTGCCTCAAATCAGAAGAAAGG + Intergenic
1011991775 6:93529487-93529509 TTTCCTGCAAATCCTAGGAAAGG - Intergenic
1012181897 6:96164661-96164683 TATGCCCAAATTCCAAAGAAAGG + Intronic
1015845872 6:137520093-137520115 TTTCAACCAAAACCAAAAAAAGG - Intergenic
1016665644 6:146636949-146636971 TTTCCTCTAAGTCCAGAGAAAGG + Intronic
1016928674 6:149380232-149380254 TTTCCCCCCACCCCAGAGAAGGG - Intronic
1017141688 6:151196695-151196717 TTTCTCCCAGATCCCAGGAAAGG + Intergenic
1017714199 6:157196703-157196725 TTTCCCCCAGACAGAAAGAAGGG - Intronic
1018732788 6:166665391-166665413 TGTCACCCAAACCCAAAGAAGGG + Intronic
1021146475 7:17095270-17095292 TTTCCCTCAAATCACAAGCAAGG - Intergenic
1021422464 7:20461236-20461258 TTTCTTCCTAATCCAAAGCAAGG - Intergenic
1022945135 7:35275780-35275802 TTTCCCCTCAAGCCAAAGACTGG + Intergenic
1023574523 7:41611852-41611874 TTTTTCCAAAATCAAAAGAAAGG - Intergenic
1024353040 7:48386951-48386973 TTTCCTCCAATTCTACAGAATGG - Intronic
1024919197 7:54539786-54539808 TTTCCCCCAAAACCTAAAATAGG - Intergenic
1026175950 7:67997186-67997208 TTTAACCCAAGTGCAAAGAATGG - Intergenic
1026598168 7:71751915-71751937 TTGCAGCCAAAACCAAAGAAAGG - Intergenic
1027004164 7:74677976-74677998 TGTCCCCCTATTCCAAAAAATGG - Intronic
1027491330 7:78831077-78831099 TTTTCCCCAAATTCAGAGCAAGG + Intronic
1029324922 7:99797874-99797896 TATCAACCAAATACAAAGAAAGG + Intergenic
1032423332 7:131800824-131800846 GTTGCCACAAATCCAAAGCATGG - Intergenic
1034975520 7:155447073-155447095 TTACCCCCAAATTCAACAAATGG - Intergenic
1036504531 8:9343387-9343409 TTTCCCCCAAATCTGATGAATGG + Intergenic
1037209684 8:16371445-16371467 TGTCCCCGAACTCCAAAGACAGG + Intronic
1037707215 8:21325558-21325580 TTTCTCACAAATCCATAGATTGG + Intergenic
1037914346 8:22763565-22763587 TTTCCCCCATATCTACAAAATGG + Intronic
1038087849 8:24219611-24219633 TTTTCCCCAAATACAATCAATGG - Intergenic
1038486462 8:27938580-27938602 TTTCCCTTAAATGCAAAGAAAGG - Intronic
1039094025 8:33863964-33863986 TTTCCCACAATTCTAAAGACTGG - Intergenic
1039190142 8:34964275-34964297 TTGCCACCAAAACAAAAGAAAGG - Intergenic
1039289806 8:36082297-36082319 TTTCTTCCAGATCCACAGAATGG + Intergenic
1041871396 8:62638607-62638629 TTTACCCCAAATGCCAAAAATGG + Intronic
1042576068 8:70219903-70219925 TTTCCCCCAACTCAAAATACTGG + Intronic
1043780810 8:84332804-84332826 TTTTCTCTGAATCCAAAGAATGG - Intronic
1044446080 8:92277702-92277724 TTTTCCCCATATTCAAAAAATGG + Intergenic
1044608124 8:94064674-94064696 ATTTCCCCAAATCCAAAGTTTGG + Intergenic
1046420079 8:113970001-113970023 TTTCTGCCAAATGCAAATAAAGG - Intergenic
1046683775 8:117201436-117201458 TGGGCCCCAAGTCCAAAGAAGGG - Intergenic
1047504532 8:125468759-125468781 TTTCCCCCAATTCTGTAGAAGGG + Intergenic
1047831552 8:128636312-128636334 TCTACCACAAATACAAAGAAGGG - Intergenic
1048277290 8:133076566-133076588 TTTCCCCCAAATTCACACAGAGG + Intronic
1048336251 8:133504588-133504610 TTTCCCCCAAGTCCTGAGATAGG + Intronic
1050303781 9:4286037-4286059 TTTCCTCCAAATCCTGGGAAAGG - Exonic
1055898886 9:81211907-81211929 TTTCCCACAAATTCAATGACTGG - Intergenic
1056836238 9:89957914-89957936 TGTACCCCAAATCCAAGCAAAGG - Intergenic
1056847091 9:90048583-90048605 CTTCCCCAAAATAGAAAGAATGG - Intergenic
1058035586 9:100249094-100249116 TTTCCCCCAAATGAAAAGGGGGG + Intronic
1061201763 9:129142140-129142162 TTTCTCCCACAGCCAAAAAAAGG - Intronic
1185504308 X:620086-620108 ATCCCCCCAACTCCAAGGAACGG - Intergenic
1185614693 X:1413727-1413749 TGTCCCCTAAATCCAATGACAGG + Intronic
1186193325 X:7087199-7087221 TGGACCCTAAATCCAAAGAAAGG + Intronic
1187585474 X:20656534-20656556 TTTCCTCCAAATCTCATGAATGG - Intergenic
1187626286 X:21117721-21117743 TTTCCCCTAACACCAAAGTAGGG - Intergenic
1187641441 X:21295209-21295231 TTTCCCACAAATTCAAACAAAGG - Intergenic
1191261719 X:58329802-58329824 TTTCCGTCGAATCGAAAGAAAGG - Intergenic
1192300224 X:69893257-69893279 TGGGCCCCAAATCCAAAGACAGG - Intronic
1194342669 X:92723720-92723742 TTTCCCCAAATTCCAGGGAAGGG + Intergenic
1194592691 X:95818841-95818863 TTTCCCCCAAATCTTCAGAATGG + Intergenic
1198103947 X:133445121-133445143 GTTTCCTCAAATCCAAAGAAAGG + Intergenic
1201905299 Y:19080767-19080789 TTTCCTCCAATTCTAAGGAAGGG - Intergenic