ID: 1127483174

View in Genome Browser
Species Human (GRCh38)
Location 15:59395874-59395896
Sequence TTCCCCCAAATCCAAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 254}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127483164_1127483174 18 Left 1127483164 15:59395833-59395855 CCACCCTCCCCCTTTCTCCTAGT 0: 1
1: 1
2: 5
3: 82
4: 890
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483165_1127483174 15 Left 1127483165 15:59395836-59395858 CCCTCCCCCTTTCTCCTAGTCAG 0: 1
1: 0
2: 3
3: 45
4: 407
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483172_1127483174 -8 Left 1127483172 15:59395859-59395881 CCTGTGCGATATAATTTCCCCCA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483167_1127483174 11 Left 1127483167 15:59395840-59395862 CCCCCTTTCTCCTAGTCAGCCTG 0: 1
1: 0
2: 3
3: 26
4: 283
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483170_1127483174 8 Left 1127483170 15:59395843-59395865 CCTTTCTCCTAGTCAGCCTGTGC 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483168_1127483174 10 Left 1127483168 15:59395841-59395863 CCCCTTTCTCCTAGTCAGCCTGT 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483166_1127483174 14 Left 1127483166 15:59395837-59395859 CCTCCCCCTTTCTCCTAGTCAGC 0: 1
1: 0
2: 0
3: 22
4: 290
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483171_1127483174 1 Left 1127483171 15:59395850-59395872 CCTAGTCAGCCTGTGCGATATAA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254
1127483169_1127483174 9 Left 1127483169 15:59395842-59395864 CCCTTTCTCCTAGTCAGCCTGTG 0: 1
1: 0
2: 0
3: 32
4: 244
Right 1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127483174 Original CRISPR TTCCCCCAAATCCAAAGAAA GGG Intronic
901149504 1:7091804-7091826 TCCCCCCAAATCAGAAGCAATGG + Intronic
901827139 1:11869674-11869696 TTCTCCCCAACCCAAAGAGAGGG - Intergenic
903838017 1:26218542-26218564 TCCCCCCAACCCCAAAAAAAAGG - Intergenic
904469078 1:30724726-30724748 TTGACCCAAATGCAAAGAAGGGG - Intergenic
906351949 1:45068739-45068761 TTCCACTAAATGCCAAGAAAGGG - Intronic
907117132 1:51978792-51978814 TTTCCCCAAGGGCAAAGAAAGGG + Intronic
908954371 1:69604082-69604104 TTTCCCCAGGTCCGAAGAAAAGG - Intronic
909475255 1:76074736-76074758 TTCCCGCAGATCCAAATAAGGGG - Exonic
917028969 1:170669026-170669048 TTCCCCAAAATTCTAAGAGAAGG - Intronic
918283625 1:183029938-183029960 TACCCCCAAATCGAGAGACATGG - Intronic
918741342 1:188134659-188134681 TTCTCCCTAATGTAAAGAAAAGG - Intergenic
919481895 1:198100265-198100287 TTCCCTCAAGACCAAAGGAAAGG + Intergenic
923720606 1:236463832-236463854 TTGTCCCATCTCCAAAGAAATGG + Intronic
924273349 1:242358502-242358524 TCCACCCAAATTCAGAGAAAAGG - Intronic
924818070 1:247460219-247460241 TTCCCCCAACTGCAGAGATATGG - Intergenic
1062916518 10:1244436-1244458 TTCCACGGAATCCAAAGAGAAGG - Intronic
1063688348 10:8259828-8259850 TGCCCACAAATCCACAGATACGG - Intergenic
1064631484 10:17318050-17318072 TTCAGCCAAATCCAAAGGCAAGG - Intergenic
1064864878 10:19868125-19868147 TACCCCCAAACCCAAAATAAAGG - Intronic
1064889035 10:20147957-20147979 TTCCTCCAAATGTCAAGAAAGGG + Intronic
1065122245 10:22541670-22541692 TCCTCCAAACTCCAAAGAAATGG - Intronic
1066711368 10:38238150-38238172 TCCACCCAAATCCAGAGAAAAGG + Intergenic
1070361335 10:75692651-75692673 TTCCACCAAATCCAGAAAATAGG + Intronic
1071306007 10:84299202-84299224 CTCCCCAAAATCCAAAGGGATGG - Intergenic
1071969588 10:90889617-90889639 TTTCACCACAACCAAAGAAAAGG - Intronic
1072636589 10:97182230-97182252 TCCCCCGAAATGGAAAGAAATGG - Intronic
1075143059 10:119857640-119857662 CTCCCTCAAATCCAGAAAAATGG + Intronic
1079792743 11:24759583-24759605 TTCCCCCAAATCCCCATATATGG - Intronic
1080354372 11:31424659-31424681 GTCCCTAAAATCCAAAGATAAGG - Intronic
1081988560 11:47325159-47325181 TGCTCCCCAATCAAAAGAAAGGG - Intronic
1084234855 11:67780751-67780773 ATCAGCCAAATCCAAAGTAAGGG + Intergenic
1084883819 11:72190479-72190501 TTCCCCCAAGGCCAAGGAGAAGG + Exonic
1085295037 11:75426713-75426735 GGCCCCCAGATCCAAAGGAAGGG + Intronic
1086500162 11:87444619-87444641 TTCCCCAAAATTAAAAGAGAGGG - Intergenic
1086770413 11:90757034-90757056 TTCTCCCAAATGCAAACTAAAGG + Intergenic
1087729677 11:101764333-101764355 ATTTCCCAAATCCAAACAAAAGG + Intronic
1087739478 11:101871109-101871131 TTCCCACACAGCCAAACAAAAGG - Intronic
1087826095 11:102766495-102766517 TGACCCAAAATCCAAAGAGAAGG - Intergenic
1088712555 11:112521707-112521729 CTCCCCCAGACCCAAAGAGAGGG - Intergenic
1088735939 11:112727738-112727760 TACCCCCACCTCCAAAGAAGGGG - Intergenic
1090427878 11:126622334-126622356 TGACCCCAAATCCAGAGAATGGG - Intronic
1090835592 11:130451126-130451148 GTCCCCCAAATCAGAAGAAGAGG - Intronic
1091059338 11:132447113-132447135 TTCCCCCAAAGGCAAGCAAAGGG - Intronic
1092120849 12:6042743-6042765 TGACCCCAAATCCAAAAAAGAGG - Intronic
1093214248 12:16345023-16345045 TTTCCCTAAATCCACAGAACAGG - Intergenic
1093431967 12:19094638-19094660 TTCCGCCAAAAACATAGAAATGG + Intergenic
1094294730 12:28891912-28891934 TTCCTCCAAACTCAAAAAAAAGG + Intergenic
1095183755 12:39177790-39177812 TTCTCCAAAATCCACAGAGAAGG + Intergenic
1095568320 12:43652326-43652348 TTGCCCAATATCCCAAGAAAAGG + Intergenic
1095877125 12:47091503-47091525 TTCCCCCAAATTGAGTGAAAAGG - Intronic
1096380941 12:51157602-51157624 TACCCTCAATTCCACAGAAATGG - Intronic
1096738888 12:53677232-53677254 TTCTCCCAAATCCGATTAAATGG - Intronic
1099065002 12:77965148-77965170 TACCCCCAAATCCAGGGAGATGG + Intronic
1099551576 12:84052048-84052070 TCCCCCCAACTCCAAAAAAAAGG - Intergenic
1099589165 12:84564877-84564899 ATCCTCTAAATCTAAAGAAAAGG - Intergenic
1100195926 12:92244361-92244383 TTCTCCCAAAGCCCAATAAATGG + Intergenic
1103381579 12:120497675-120497697 TGCCCCCAATTCCAAGAAAACGG - Intronic
1104941320 12:132396807-132396829 TACCCCCAAATCTAGAGAAGAGG + Intergenic
1106418496 13:29566049-29566071 TTTCGCCAAAACCCAAGAAAAGG + Intronic
1109231369 13:59761991-59762013 GTCCCCCATAGCCAAAGAAGAGG + Intronic
1110917881 13:81046100-81046122 TTCACCCAGATCAAAAGACATGG - Intergenic
1111092794 13:83469226-83469248 TGCCCCCAATTCCTCAGAAACGG - Intergenic
1111698417 13:91655730-91655752 TTCCCCCAAAGTCAAACATAGGG - Intronic
1111716420 13:91885210-91885232 TTTACCCAAATACAAAGAGACGG - Intronic
1115354119 14:32428933-32428955 TTTACACAAATCCAAAGAAGAGG - Intronic
1116215026 14:42004932-42004954 TTCTCCTAAAACCACAGAAATGG + Intergenic
1120336578 14:83164667-83164689 TTCCTCCAAATCCAAGGTCAAGG + Intergenic
1121040511 14:90742695-90742717 TTTCCCCAAAATCAAAGAAAAGG + Intronic
1121888733 14:97569402-97569424 GTTTCCCAAATACAAAGAAAAGG - Intergenic
1121895008 14:97638652-97638674 TTCCCCTAAATGAAAAAAAAAGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124407840 15:29407668-29407690 CTCCCCCCAACCCAAAAAAATGG - Intronic
1125352519 15:38782652-38782674 ATCCCCAAAATCCAATGACAAGG - Intergenic
1126253346 15:46594786-46594808 TTCACACAAAACCAAAAAAAGGG - Intergenic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1127953346 15:63832140-63832162 TTCCCCCAAATCACATGACAAGG - Intronic
1129176979 15:73847315-73847337 TTTCCCCAAAACCAAAGGGAAGG + Intergenic
1130635578 15:85616613-85616635 GTTCCCCAAATTAAAAGAAAAGG + Intronic
1131290574 15:91103346-91103368 TTCCCCCACACTAAAAGAAAAGG + Intronic
1131364954 15:91831089-91831111 TACCCCCCAATCCCCAGAAAGGG + Intergenic
1131483342 15:92800454-92800476 TTCCCCCAAAACCCAAAAAATGG - Intronic
1131982685 15:98010630-98010652 TACCCCCATCTCCAAAGAAAAGG - Intergenic
1132058313 15:98669459-98669481 TTCTAACAAAGCCAAAGAAAAGG - Intronic
1135206164 16:20485901-20485923 TATTCCCAAATCCAAAGATATGG - Intronic
1135212758 16:20538021-20538043 TATTCCCAAATCCAAAGATATGG + Intronic
1136328650 16:29553676-29553698 TTCACTTAAATCCAAAAAAATGG + Intergenic
1136443337 16:30293689-30293711 TTCACTTAAATCCAAAAAAATGG + Intergenic
1137271709 16:46906692-46906714 TTCCCACAGTTCCAAAGCAATGG + Intronic
1139425528 16:66877575-66877597 CTCACTCAAAACCAAAGAAATGG - Intergenic
1140696037 16:77535346-77535368 CTGCCCCAAGTCCCAAGAAAGGG + Intergenic
1140935494 16:79666004-79666026 TTCCCCCAAAGCCAACCAGAGGG + Intergenic
1142379649 16:89724033-89724055 TTCTCCCACATCCACAGACAAGG - Intronic
1142755055 17:2011516-2011538 TTGCCCCACATCCAAAGCCATGG - Intronic
1143994319 17:10993549-10993571 TACCCCCAATTCCAAATTAAGGG - Intergenic
1144067008 17:11633639-11633661 TTGAACCAATTCCAAAGAAAGGG + Intronic
1145943610 17:28757615-28757637 TCCCCCCATATCTCAAGAAATGG + Exonic
1146694791 17:34900209-34900231 CTTCCTCAAATACAAAGAAATGG - Intergenic
1149021052 17:51964929-51964951 CCCCCCCAAATCCATACAAAGGG + Intronic
1149331467 17:55587164-55587186 ATCAACCAAATCTAAAGAAAAGG - Intergenic
1151037807 17:70821575-70821597 TTCCACCAAAGCCAAATAATGGG + Intergenic
1151067412 17:71167665-71167687 TTCCCCCAAACCCAAAGCAATGG + Intergenic
1151526153 17:74670199-74670221 TTCCCCCAAACCCAATAAAGTGG + Intergenic
1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG + Intergenic
1152513586 17:80807348-80807370 TTCCCCCCGCTCCAAAAAAAAGG - Intronic
1155110471 18:22709340-22709362 CTCCAGCAAATTCAAAGAAAAGG + Intergenic
1156222830 18:35070873-35070895 TTCCCACAAATGAAAAGAAGGGG - Intronic
1156542222 18:37925481-37925503 TTTCCCCAAAACTACAGAAAGGG + Intergenic
1157722259 18:49934358-49934380 TTCCTCCCAATACAAAGAAAAGG - Intronic
1159159900 18:64630647-64630669 TTTTCCCATATCCTAAGAAAAGG + Intergenic
1159712691 18:71782250-71782272 TTCCCCCAAATTACAAGGAATGG - Exonic
1161233153 19:3185641-3185663 CTCCCCCAACGCCAAAGACAAGG + Exonic
1163338575 19:16689515-16689537 CTCCCCCTAAACCAAAGAAATGG + Exonic
1163879925 19:19910203-19910225 TTCCCCCAAATCTCAAGACCTGG - Intronic
1165175684 19:33928114-33928136 TTCCCCACAAGCTAAAGAAATGG + Intergenic
1166285016 19:41820259-41820281 TTCCCTCTAATACTAAGAAAAGG - Intergenic
925109532 2:1322327-1322349 CTCCCCCAAAGCCAGAGACACGG + Intronic
926544651 2:14224885-14224907 TTCACCCAAATCCCCAAAAAGGG + Intergenic
927500334 2:23578432-23578454 TTCCCCACAAGCCAATGAAATGG - Intronic
927739153 2:25551693-25551715 CTACACCAAATCCATAGAAATGG - Intronic
927766808 2:25817845-25817867 TGCCCACAAATACAAAGAAGGGG + Intronic
928949542 2:36802348-36802370 GTCATCAAAATCCAAAGAAATGG + Intronic
930596193 2:53391135-53391157 TTCCCCCTAAACAAGAGAAAGGG + Intergenic
934530862 2:95087688-95087710 TTAACCCAAATCCACTGAAATGG - Intronic
935590052 2:104838687-104838709 TTACCCCAAATCTAAACAAAGGG - Intergenic
935606564 2:104977289-104977311 TTCTCCCAATACCAAAGCAATGG - Intergenic
936860338 2:117009619-117009641 TTCACACAAACACAAAGAAATGG + Intergenic
937527984 2:122794615-122794637 ATCCCCCAAACTCAAAGAAGTGG - Intergenic
938665557 2:133532225-133532247 TTACCCCAATTCCAAAAGAATGG + Intronic
939512782 2:143127222-143127244 TTCCACCTTATACAAAGAAAAGG + Intronic
940178213 2:150902911-150902933 GCCCCCCAAATCCAAATAACAGG + Intergenic
940591408 2:155732852-155732874 TTCACCCATATCCTTAGAAAAGG - Intergenic
941364884 2:164598166-164598188 TTCTGCCAAAGCCAAATAAAGGG + Intronic
941753501 2:169160036-169160058 TTTCCCCAAACCCAAACATATGG + Intronic
942124996 2:172815277-172815299 TTCCTCCAGAGCCAAACAAATGG + Intronic
942458526 2:176153477-176153499 TGGCCCCACCTCCAAAGAAATGG + Intronic
942601822 2:177648306-177648328 CTCCCCAAAAGCCAAAGATATGG + Intronic
943470063 2:188283871-188283893 TACCCCCAAATCTAAAATAAAGG + Intergenic
944343480 2:198632174-198632196 CTCCCCAAACTCCAAAGGAATGG + Intergenic
945193491 2:207215221-207215243 TTATCCCAAATGAAAAGAAAAGG - Intergenic
948198692 2:236113941-236113963 ATCCCCAAAATAAAAAGAAAAGG - Intronic
1169614766 20:7428109-7428131 GTCACACAAATCCAAAGAAAAGG - Intergenic
1169762799 20:9114714-9114736 TTCCCCCAACCCCAAATTAAAGG + Intronic
1170037081 20:12001034-12001056 TTTACCCAACACCAAAGAAATGG - Intergenic
1170763296 20:19270611-19270633 ATCCACCAAATCCCAAGAATGGG - Intronic
1171502284 20:25603315-25603337 TTCACCCAAACCCAGAGAATGGG + Intergenic
1177727829 21:24991782-24991804 CTCCCTCAAACCCAAAGAATAGG + Intergenic
1178419475 21:32432098-32432120 ATCAGCCAAATCCAAAGTAAGGG - Intronic
1178695033 21:34785672-34785694 TTCCCCCGACCCCCAAGAAATGG + Intergenic
1178723641 21:35032196-35032218 TTCCCCTAAATAGAAAGATATGG + Intronic
1180143386 21:45906492-45906514 TGACCCCAAATCCAAAAGAAGGG - Intronic
1180698751 22:17770402-17770424 CTCCCCCAAAACCAAAGAGAAGG - Intronic
1181267142 22:21636950-21636972 TCCCCCCAAGTCCAAGGACATGG + Exonic
1182700007 22:32229103-32229125 TTTCACCAAAGCCAAAGACAAGG + Intronic
1182800770 22:33030081-33030103 TTCCCCCAAACCCACAGTGATGG - Intronic
1182970471 22:34569744-34569766 TTCCCCCATTTCCAAAGTACAGG + Intergenic
951293324 3:20900865-20900887 TTACTCCAAATCCAAAGATTTGG - Intergenic
952055348 3:29437767-29437789 TTCCCCCATATACAAAATAATGG + Intronic
952161684 3:30700118-30700140 GTCACCCAAATTCAAAGCAATGG + Intergenic
952199524 3:31111728-31111750 TAGCCCCAAAACCTAAGAAATGG + Intergenic
952330311 3:32358696-32358718 TTTCCCCAAATCCAAAAGTAAGG + Intronic
953838195 3:46366014-46366036 TCTCCTCAAAGCCAAAGAAAGGG - Intergenic
955102183 3:55861008-55861030 TTCCCCCAAATAGAAAGGTAGGG + Intronic
955123744 3:56088448-56088470 TCATCCCAAATCCAAAGAAGGGG + Intronic
955765233 3:62337148-62337170 TTTCCCTACTTCCAAAGAAAAGG + Intergenic
957022957 3:75144501-75144523 GTCCCCTGTATCCAAAGAAAAGG + Intergenic
958068296 3:88574385-88574407 TTCCCACTAATGCTAAGAAATGG + Intergenic
958462153 3:94412577-94412599 TTCCCCCAAATCCCAAGTGCTGG - Intergenic
958600539 3:96290492-96290514 TTTCACCAAATTCAAACAAAAGG + Intergenic
960285889 3:115828138-115828160 TTCAGACAAAACCAAAGAAAAGG - Intronic
961485453 3:127212765-127212787 TTCCCCCACATCCCAACACATGG + Intergenic
961884486 3:130087286-130087308 ATCAGCCAAATCCAAAGTAAGGG + Intronic
962036927 3:131661955-131661977 TTCCCCCAAACCCATAGAAAGGG - Intronic
962383159 3:134912911-134912933 TTCCCCCAAATCCTAAAAGATGG - Intronic
963589671 3:147242273-147242295 CTCCCCCTAATACAAAGAAAAGG + Intergenic
964748569 3:160034067-160034089 TTCCTCCAAATGCCAGGAAATGG + Intergenic
966110349 3:176393604-176393626 TGCCCTCAAGTGCAAAGAAATGG - Intergenic
966116073 3:176462838-176462860 TTTCCCCAAATAAAAAGAAATGG - Intergenic
967193154 3:187002629-187002651 TCACCCCAAATCCTAAGCAAAGG - Intronic
969820296 4:9715001-9715023 ATCAGCCAAATCCAAAGTAAGGG - Intergenic
972407533 4:38761280-38761302 TTCCCCCAAAACCAAAGTCAGGG + Intergenic
973225185 4:47775862-47775884 AAGCCCCAAATCCATAGAAATGG - Intronic
973804365 4:54511370-54511392 TTCACCAAAATTGAAAGAAAAGG + Intergenic
975895447 4:79084679-79084701 TGCCACCATATCCAGAGAAAGGG - Intergenic
977338104 4:95723379-95723401 TTCCTCCAAATCTAAACAGAGGG - Intergenic
978266036 4:106825610-106825632 TTCGCCAAATTTCAAAGAAATGG + Intergenic
980737249 4:136906286-136906308 TTCCCCCAAATTCTGACAAATGG + Intergenic
980917675 4:139049189-139049211 TTCACTCAAAGCCAAAGAAATGG - Intronic
981009343 4:139909535-139909557 ATCCCACAAACCCAAAGATAAGG + Intronic
981321351 4:143395806-143395828 TACCCCCAAGTCCTTAGAAAGGG - Intronic
981396821 4:144260063-144260085 TTTCTTCAAATCGAAAGAAAAGG + Intergenic
983489674 4:168373706-168373728 TTCCCCGAAAGACAAACAAATGG + Exonic
985685881 5:1281265-1281287 CTCCCCCAGATGCAAGGAAATGG + Intronic
985731787 5:1553564-1553586 CTCCCCAAAATCCAAAGGAGTGG - Intergenic
985862554 5:2484979-2485001 TTCCCCCAAATGCAAATATGCGG - Intergenic
986284760 5:6351062-6351084 TTCCTCCAAAGCCATGGAAATGG + Intergenic
986409529 5:7463432-7463454 TTCCCTCAAGTGCAAAGGAAGGG - Intronic
990314188 5:54568533-54568555 TTCCCCCATTTCCAAAGGAAGGG + Intergenic
990511199 5:56490896-56490918 TTTTGCCAAATCCAAGGAAAAGG + Intergenic
991438489 5:66620932-66620954 TCCCCCCTAATTCAGAGAAAGGG + Intronic
992970625 5:82053323-82053345 TTCCACCAAATCAACAGGAAGGG - Intronic
994300770 5:98144409-98144431 TTCCAACAAATCCAAATATAGGG + Intergenic
997689918 5:135821451-135821473 TTCCCCCAAGTCCAGGGAACTGG - Intergenic
998045944 5:138986901-138986923 TGCCCCCAAATCCTTGGAAAAGG + Intronic
999073651 5:148774284-148774306 TTCCCCCAAATCATAAGAATAGG + Intergenic
1002855088 6:1029167-1029189 TGCCCCCAAATCTAAGGAAAGGG + Intergenic
1003269397 6:4593803-4593825 TTCTCCCAAATACAAAGACTAGG + Intergenic
1004594711 6:17088182-17088204 TCTACCCACATCCAAAGAAAAGG - Intergenic
1006273602 6:32983284-32983306 TTCCCCCACAACCCAACAAAAGG - Intergenic
1007198372 6:40083414-40083436 TTTCCTCAAATAGAAAGAAAAGG + Intergenic
1007911598 6:45520573-45520595 TGCCCCCCAGTGCAAAGAAATGG - Intronic
1007914707 6:45550452-45550474 TTCCCTCAATTCCGAGGAAAGGG + Exonic
1008552760 6:52648744-52648766 TTCTCTCAAATGCAGAGAAAGGG - Intergenic
1008881465 6:56384376-56384398 TTCCCACAGATCAAAATAAAAGG - Intronic
1009635535 6:66259925-66259947 TTCCCCCAAGACAAAAGGAAAGG - Intergenic
1009677084 6:66839673-66839695 TTCACACACACCCAAAGAAACGG + Intergenic
1009797479 6:68490473-68490495 TTCACACAAATCCAAATTAATGG - Intergenic
1014110852 6:117617341-117617363 TTCCCCTAAAGGGAAAGAAAAGG - Intergenic
1017128295 6:151086411-151086433 GTCCCTCACATCCAAAGAAAAGG + Intronic
1017396878 6:154011053-154011075 TTCCAGCAAATGCAATGAAAAGG - Intronic
1018021108 6:159762650-159762672 TTTCCCCAAATCCGAAGGACTGG - Intronic
1019858778 7:3636966-3636988 TTTCTCCAAAGCCACAGAAATGG - Intronic
1022270133 7:28798871-28798893 TTCCACCTAATGCCAAGAAAAGG - Intronic
1022367101 7:29732091-29732113 TTTCCCCAATTCCTAAGAATTGG - Intergenic
1022561627 7:31355609-31355631 TTCCTCCAAATAGGAAGAAATGG - Intergenic
1022857567 7:34330499-34330521 CTGCCCCAAATACAAACAAAGGG - Intergenic
1023188225 7:37553057-37553079 TGCCTCCAAATCCATAGTAAAGG + Intergenic
1023525835 7:41101977-41101999 ATCCCAGAAATCAAAAGAAAAGG + Intergenic
1026599639 7:71766862-71766884 GTCCCCCAAAACCACAGACATGG + Intergenic
1028141740 7:87282005-87282027 TTCCACCAAATCCCAATAACAGG - Intergenic
1029647283 7:101865851-101865873 TTCCCCTGAATCCACTGAAATGG - Intronic
1032599335 7:133276604-133276626 TCACCCCAAAACCAAAGAAGAGG - Intronic
1033444137 7:141405380-141405402 TTTCCCCAAGTCCAGAGACAAGG + Intronic
1033852227 7:145511624-145511646 TTCCCCCAAATGAAGAGACATGG + Intergenic
1036504532 8:9343388-9343410 TTCCCCCAAATCTGATGAATGGG + Intergenic
1037158845 8:15741982-15742004 TTACCCCGAATCCACAGACATGG - Intronic
1037239216 8:16758632-16758654 TGCGCTCATATCCAAAGAAAGGG - Intergenic
1038122228 8:24630137-24630159 TTCTCCAAAATCCAAGGAGATGG + Intergenic
1038253783 8:25931249-25931271 TTCCCACAATTTAAAAGAAAAGG - Intronic
1038486461 8:27938579-27938601 TTCCCTTAAATGCAAAGAAAGGG - Intronic
1039459422 8:37730974-37730996 CTGTCCAAAATCCAAAGAAATGG + Intergenic
1040804922 8:51384024-51384046 TTCCCCAAAACACAAAGGAAAGG + Intronic
1041790524 8:61691692-61691714 TTCCCCCAAATCAAATTTAATGG - Intronic
1041854999 8:62441955-62441977 TTTTCCCAAATGCAAAAAAAGGG - Intronic
1043052248 8:75398450-75398472 TTTCCATTAATCCAAAGAAAAGG + Intergenic
1043871633 8:85439327-85439349 TTCTCCCTAATCCAAGGCAAAGG + Intronic
1044191121 8:89318918-89318940 TACCTCCAATTACAAAGAAAGGG + Intergenic
1044515234 8:93129998-93130020 TTTCCCCAAATCAAACCAAAAGG - Intergenic
1044608125 8:94064675-94064697 TTTCCCCAAATCCAAAGTTTGGG + Intergenic
1047245935 8:123144699-123144721 TTCCACTAAATTCAAATAAATGG - Exonic
1047455928 8:125011505-125011527 ATCCCACCAACCCAAAGAAATGG - Intronic
1048787061 8:138061950-138061972 TTGCCCCAACTCCAAGGAGATGG + Intergenic
1051494770 9:17707910-17707932 GTCTCCCAAATCCAAATAAAAGG + Intronic
1051692046 9:19725219-19725241 TTCCCCCCACAACAAAGAAATGG + Intronic
1052676746 9:31635788-31635810 TTACCCCAAATTCATAGTAATGG - Intergenic
1056836237 9:89957913-89957935 GTACCCCAAATCCAAGCAAAGGG - Intergenic
1058066986 9:100560147-100560169 CTCCCCAAAATACAAATAAAAGG - Intronic
1058096531 9:100866975-100866997 CTCCCCAAAATCTAAAAAAAAGG + Intergenic
1059446842 9:114343373-114343395 TTCCCCCAAGTCCACAGGAGTGG - Intronic
1061025872 9:128049108-128049130 TAACACCAAATCCAAACAAATGG + Intergenic
1061201762 9:129142139-129142161 TTCTCCCACAGCCAAAAAAAGGG - Intronic
1185504307 X:620085-620107 TCCCCCCAACTCCAAGGAACGGG - Intergenic
1185718803 X:2365619-2365641 TTCCTCAAAATACACAGAAATGG + Intronic
1186656647 X:11619218-11619240 TTCCCTCCAATCCAAAGATCTGG - Intronic
1186708615 X:12169212-12169234 TCCCCCTAAATACAAAGGAAAGG + Intronic
1187799551 X:23045409-23045431 TTCCCCCCAAAACAAATAAAAGG + Intergenic
1187956296 X:24522494-24522516 TCACCCCAAATCTCAAGAAAAGG - Intronic
1188558982 X:31446075-31446097 TTCCTCCCACTCCAAATAAAAGG + Intronic
1188921255 X:35980443-35980465 TTCCCCAAACCCCAAAGAACAGG + Intronic
1189739670 X:44105016-44105038 TCCCACCCAATCCACAGAAAAGG - Intergenic
1189843648 X:45109882-45109904 TTGCACCAAATCCAAAGACATGG - Intronic
1190119553 X:47649417-47649439 TTCCCCCAATTACAAAGCACTGG + Intronic
1190314300 X:49139918-49139940 GTCCCCTATCTCCAAAGAAAAGG - Intergenic
1190726111 X:53191942-53191964 TTCCCTCAAGTCCAAACAGATGG - Intronic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1195992902 X:110700558-110700580 TTCTAGCAAATCCAAAAAAAAGG - Intronic
1196051246 X:111307659-111307681 TTACCCCAAAGCAAGAGAAATGG + Intronic
1196959692 X:120988086-120988108 TTCCTCCAAATCCAAATTAGAGG - Intergenic
1197820960 X:130540519-130540541 GTCTCACAACTCCAAAGAAAGGG - Intergenic
1198049138 X:132931595-132931617 TGCCTCCAACTCCAAAGCAATGG + Intronic