ID: 1127487442

View in Genome Browser
Species Human (GRCh38)
Location 15:59432404-59432426
Sequence GTGCTGTCCTTGGGGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127487437_1127487442 23 Left 1127487437 15:59432358-59432380 CCCTCAAAATAAATTTTTATAAG 0: 1
1: 0
2: 7
3: 141
4: 1158
Right 1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 204
1127487438_1127487442 22 Left 1127487438 15:59432359-59432381 CCTCAAAATAAATTTTTATAAGT 0: 1
1: 0
2: 15
3: 192
4: 1519
Right 1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127487442 Original CRISPR GTGCTGTCCTTGGGGAAGAC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900469613 1:2847283-2847305 CTGCTGGCCTTGGGGGAGGCGGG - Intergenic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902614171 1:17614824-17614846 GTGCTGTGCATGGGGAAGCAGGG - Intronic
902749850 1:18500046-18500068 GAGCTGTTCTTGGGCAAGAGGGG + Intergenic
902815105 1:18911928-18911950 GTCCTGGCCTTTGGGAAGCCAGG + Intronic
904680928 1:32228671-32228693 GAGCTTTCCTGGGGGAAGTCGGG - Intronic
906253847 1:44332419-44332441 GAACTTTCCTTGGGGAACACTGG - Intronic
907470782 1:54672126-54672148 GTGGTGCCCTTGGAGAAGACTGG + Intronic
908577150 1:65472293-65472315 GGGCTGTCATTTGGGAAAACGGG + Intronic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
911255230 1:95625521-95625543 ATGCTGTACTTGGAGAAGGCTGG + Intergenic
912912487 1:113776239-113776261 GAGGTGTGCTTTGGGAAGACAGG - Intronic
913055895 1:115159407-115159429 TTTCTTTCCTTGGGGAAGAGAGG - Intergenic
915129382 1:153686423-153686445 GTGATGTCCCTGGGGGAGAGAGG + Intronic
917856596 1:179106134-179106156 GAGCTCTCCTTGGGGAGGATGGG + Exonic
920232607 1:204480608-204480630 GTGCTGTCTGTGGGGAGGATGGG + Intronic
920366186 1:205449555-205449577 GTGCTGTTGTTGGGGAATGCAGG - Intronic
920493580 1:206438053-206438075 AAGATGTCCTTGGGGAAGAGAGG - Exonic
923496648 1:234531423-234531445 GGGCTGACCATGGGGAAGAAGGG - Intergenic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924439213 1:244072657-244072679 GCGCTGGCCTTGGGGGTGACTGG + Intergenic
1064029547 10:11875219-11875241 GTATTGTCCTGGGGGGAGACGGG + Intergenic
1065814146 10:29469652-29469674 GTGGGGACCTTGGGGAAGAGGGG - Intronic
1067949761 10:50722063-50722085 ATGCTTACCTTTGGGAAGACAGG + Intergenic
1068837448 10:61570002-61570024 GAGGTGTCCTTGGGGAAGGATGG + Intergenic
1070712658 10:78694002-78694024 GTGAGGTGCTTAGGGAAGACTGG - Intergenic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1070885068 10:79887096-79887118 ATGCTTACCTTTGGGAAGACAGG + Intergenic
1071872062 10:89806665-89806687 GTGCTGTCCGTGGGGCAAGCCGG + Intergenic
1072520751 10:96227772-96227794 GCACTGTCCTTGGGGGACACAGG + Intronic
1072696717 10:97609378-97609400 GGGCTGCCCCTGGGGAAGAGTGG + Intronic
1076756688 10:132576247-132576269 GTGCTGTCCTGGGGGCAGGAGGG - Intronic
1077423674 11:2464600-2464622 GTCCTGTCCTTGGGGAGGCCTGG + Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1083742020 11:64716247-64716269 GTTCTGAGCTTGGGGATGACTGG - Intronic
1084540410 11:69782712-69782734 TTGCTGTCCTGGAGGGAGACAGG - Intergenic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1085024963 11:73231012-73231034 GTCCTGACCCTGGGTAAGACGGG + Intronic
1087179608 11:95128750-95128772 GTGCTGTCCCTGGAGGAGGCTGG + Exonic
1089139758 11:116276109-116276131 GTTCTGCTCCTGGGGAAGACAGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090351292 11:126110155-126110177 GTGGTCTCCGTGGGGAGGACTGG + Intergenic
1091158795 11:133400019-133400041 GTGATGTTCTTATGGAAGACAGG - Intronic
1093036105 12:14333924-14333946 GAGGTGACCTTGGGGAAGAATGG - Intergenic
1096506560 12:52097420-52097442 GTGCTATCCATGGGGAAGGGGGG - Intergenic
1098730862 12:74035937-74035959 GAGATCTCCTTGGGGAAGAATGG - Intergenic
1102787477 12:115616587-115616609 GTGATGTCAGTGGGGAGGACAGG - Intergenic
1103035409 12:117652633-117652655 GAGGTGTCCTTGGGGAAGGATGG - Intronic
1104588475 12:130066000-130066022 ATGCTGTCCTTGTGACAGACAGG + Intergenic
1105277636 13:18944856-18944878 GTGCCCCCCATGGGGAAGACAGG + Intergenic
1106387598 13:29302724-29302746 CTGCTGACTTTGGAGAAGACAGG + Intronic
1108605275 13:52031018-52031040 GGTCTGACCTTGAGGAAGACTGG - Exonic
1109960037 13:69617704-69617726 GTAATGTCCTTGAGGAAGAGAGG - Intergenic
1111440896 13:88281715-88281737 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
1112334417 13:98502120-98502142 GGGTTGTCCTTTGGGAACACAGG - Intronic
1113008924 13:105741031-105741053 GTGCTGTCCTGGGGGCCCACAGG - Intergenic
1113485652 13:110650648-110650670 GTGCTGCCCCTGGGCAGGACAGG + Intronic
1113494546 13:110716068-110716090 GTGCTGTCCTCGGGCCGGACGGG + Intronic
1115853217 14:37603594-37603616 CTGCTGTCTTTGGAGACGACAGG - Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1119921464 14:78450441-78450463 GACCTGTCCTTGGAGAAGACTGG - Intronic
1122693501 14:103542272-103542294 GTGCTCTGCCTGGGGAAGGCAGG + Intergenic
1122782845 14:104150880-104150902 GTGCTGTCCTGGGGGTTGCCCGG + Intronic
1123129841 14:105976069-105976091 GTGATGTCCATGTGGAAGGCAGG - Intergenic
1124194050 15:27605123-27605145 GTCATGTCCTTGGGGATGGCTGG + Intergenic
1127109792 15:55656261-55656283 ATGCCATCCTTGGAGAAGACAGG - Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1128328866 15:66742766-66742788 GAGCTGTCCTTAAGGAAGCCAGG + Intronic
1128571978 15:68740472-68740494 GTGCTGGTGTTGGGGAAGAGGGG - Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132588932 16:717988-718010 GTCCCGCCCTTGGGGAAGAATGG + Exonic
1132690766 16:1180915-1180937 GCGCTTTCCTGCGGGAAGACGGG - Intronic
1132789103 16:1675219-1675241 GCTCTGTCCTGGGGAAAGACTGG - Exonic
1135181303 16:20276811-20276833 GTGGTGCACTTGGGGAAGGCAGG + Intergenic
1135522112 16:23185815-23185837 ATGCTGCCCTTGAGGAAGGCGGG + Intronic
1135998526 16:27271833-27271855 GTGCTGCCATGGGGGAAGGCTGG - Intronic
1136075169 16:27812200-27812222 GTGCTGGGCTTGGGGACCACAGG + Intronic
1137244705 16:46693101-46693123 TTGCTGTGTCTGGGGAAGACTGG - Exonic
1137854232 16:51777732-51777754 GTGCTTTCATAGGGGAAGGCAGG - Intergenic
1139547400 16:67656137-67656159 TTGCTCTCCTTGGGGAGGAAGGG + Intronic
1140696056 16:77535463-77535485 TTGCTGACCTTGGGAGAGACAGG + Intergenic
1141331958 16:83118928-83118950 GGGCTGACCTTGAGGAAGAAGGG - Intronic
1142284296 16:89165482-89165504 GTGCTGTCCTTTGCAAGGACAGG - Intergenic
1142712912 17:1733046-1733068 GTAGTGTCCCTGGGGAAGGCAGG + Intronic
1148850336 17:50551541-50551563 GGGCTGTCCTGGGCCAAGACAGG + Exonic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1150852295 17:68715062-68715084 GTCCTCTCCCTGGGGCAGACAGG - Intergenic
1152811541 17:82385007-82385029 GTGCTTTCCTAGGGGCAGAAAGG - Intergenic
1153020072 18:620547-620569 GTGATGACCTTGGGGAAAAGGGG - Intronic
1154068271 18:11129676-11129698 GAGGTCTCCTTGGGGAAGAATGG - Intronic
1156192245 18:34733127-34733149 GAGGTCTCCTTGGGGAAGAATGG + Intronic
1157223258 18:45841778-45841800 GAGATGTCCTAGGGGAAGTCAGG + Intronic
1157541990 18:48517294-48517316 GGGCTGTCCTCAGGGAATACAGG + Intergenic
1160160726 18:76467974-76467996 GTGCTGTCCGTAGGGAGGTCTGG - Intronic
1160336253 18:78042934-78042956 ATGCTGCCCTTTTGGAAGACAGG + Intergenic
1160924223 19:1535333-1535355 GGGCTGTCCTGGGGGAGGGCTGG + Exonic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161807641 19:6454276-6454298 GTGCTTGCCATAGGGAAGACTGG - Intronic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1162110290 19:8396390-8396412 TTCCTGCCCTTGGGGCAGACTGG + Intronic
1162999244 19:14355842-14355864 TTGTGGGCCTTGGGGAAGACTGG + Intergenic
1163064889 19:14785510-14785532 TTGTGGGCCTTGGGGAAGACTGG - Intergenic
1164758450 19:30708517-30708539 CTGTTGTCCCTGGGGAGGACAGG + Intronic
1166416162 19:42596092-42596114 CTGCTGTCCTTCGTGAAGCCAGG - Intronic
1167353959 19:48992274-48992296 GTTCTGGCCTTGGAGAAGGCTGG - Intronic
1167409271 19:49335475-49335497 GTGCTGACAGTGGGGGAGACAGG - Exonic
1168423065 19:56217724-56217746 CTGCAGTCCTTGGGGAAGCGGGG + Intergenic
925499597 2:4488329-4488351 GAGCTTTCCTTGGGGAAGGATGG + Intergenic
927579887 2:24233128-24233150 GTTCTGTCCTTGGGCAATACGGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
936394535 2:112112086-112112108 GTGCGGTCCATGGTGAAGCCAGG - Intronic
937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG + Intergenic
937175042 2:119922283-119922305 TTACTGCCCTTGGGGAAGATTGG + Intronic
937336953 2:121068085-121068107 GGGCTGGCCTTGGGGAAGAGGGG - Intergenic
937435749 2:121879758-121879780 GTTCCCTCCTTGGGTAAGACAGG + Intergenic
939901986 2:147861747-147861769 GTGCTCTCATTCGGGAATACAGG - Intronic
940702006 2:157056936-157056958 GAGCTGTCCTCTGGGAAGACTGG + Intergenic
941311430 2:163937241-163937263 GTGCTAAACTGGGGGAAGACTGG - Intergenic
942198387 2:173545649-173545671 GTGCTGTCCTTCATGGAGACAGG + Intergenic
943318042 2:186413072-186413094 GAGGTCTCCTTGGGGAAGGCTGG + Intergenic
945726021 2:213472901-213472923 GAGGTTTCCTTGGGGAAGAATGG + Intronic
948157138 2:235792665-235792687 GTTCTGTCCATGGTGAAGAGCGG + Intronic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
948407984 2:237737046-237737068 GTGCAGGCCTGGGGGAAGCCTGG - Intronic
948427507 2:237897005-237897027 GTGCTGTCCGTGGGGATGGTGGG + Intronic
1169648453 20:7840792-7840814 GTGGTTTCCTTGGGAAAGTCTGG - Intergenic
1169799496 20:9500374-9500396 CTGCTGGCCTGGGGGAAGGCTGG - Intergenic
1171111017 20:22482682-22482704 GTGCTGTCCTTGGGAGGGGCAGG - Intergenic
1173417017 20:42865843-42865865 GTGCATTCCTAGAGGAAGACAGG - Intronic
1175015545 20:55786167-55786189 GTGCTGTCCTTAGAGATGAGTGG - Intergenic
1175248401 20:57594980-57595002 TTGCCTCCCTTGGGGAAGACAGG + Intergenic
1175567672 20:59993808-59993830 GTGTTGCCCCTGGGGAAAACTGG - Intronic
1176677979 21:9798828-9798850 GTGATGTCCTTGCTGACGACTGG + Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1179573573 21:42292432-42292454 GGGCTGGCCTTGGGGCACACGGG - Intronic
1179798321 21:43798557-43798579 TTGCTGTCCTCTGGGGAGACGGG - Intronic
1181147997 22:20862384-20862406 GGGATGTTCTTAGGGAAGACAGG + Intronic
1182576016 22:31273437-31273459 GCTCTTTCCTTGGGGAACACAGG - Exonic
1183278949 22:36922143-36922165 GTGCTGGCCATGGGCATGACAGG - Exonic
950449380 3:13057152-13057174 GTGTGGTGCTTGGGGAAGGCAGG - Intronic
950612903 3:14137502-14137524 GGGCTGGGCTGGGGGAAGACAGG - Intronic
951693460 3:25421040-25421062 CTGCTGCCCCTGTGGAAGACAGG - Intronic
953853470 3:46483602-46483624 GTGTTAACCTTGGGGAAGAGGGG + Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
961038825 3:123662837-123662859 GACCTGGCCTTGGGGAGGACAGG - Intronic
961051721 3:123752401-123752423 ATGCTGTCCATGAGGAGGACAGG - Exonic
961454354 3:127016834-127016856 TTCCTGTCTTTGGGGAAGGCAGG + Intronic
961567980 3:127777042-127777064 TTGCTTTCTCTGGGGAAGACGGG + Intronic
964425188 3:156545492-156545514 GTGCTGTCCTTAGGGTTGAGGGG - Intronic
967747750 3:193079324-193079346 GTGCTTTCCCAGAGGAAGACAGG - Intergenic
968621318 4:1604624-1604646 GTGCTGTCCTGGGGGAAGTAGGG - Intergenic
968819348 4:2837823-2837845 TGCCTGTCCTTGGGGAAGAGGGG + Exonic
969594774 4:8142803-8142825 GTGTTGTCCTTGGGGAGGGCAGG - Intronic
974187078 4:58459091-58459113 GGGCTAGCCTTGGAGAAGACAGG - Intergenic
974564603 4:63566902-63566924 GTGGTGTCCTTGGGAAAGGATGG - Intergenic
975699392 4:77048472-77048494 CTGTTGTCCTTGGAGAAGTCTGG + Exonic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
979612112 4:122700343-122700365 GTGCTGTCCGTGGGAAGGCCTGG - Intergenic
981834795 4:149042517-149042539 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
985397544 4:189559963-189559985 GTGATGTCCTTGCTGAGGACTGG - Intergenic
986037235 5:3951859-3951881 GTGGTATCCTTGGGGAAGGATGG + Intergenic
986153151 5:5146327-5146349 GTGCAGACGTTGGGAAAGACAGG + Exonic
986720370 5:10556799-10556821 GTGGGATCCTTGGGGAAGCCAGG + Intergenic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
992454362 5:76902688-76902710 TTGCTGTCCTTGGGGGAGGCAGG + Intronic
993412768 5:87593234-87593256 GAGGTCTCCTTGGGGAAGAATGG + Intergenic
996343333 5:122462512-122462534 GAGCTGTCCATGGGCAAGAAAGG - Intronic
998351206 5:141502811-141502833 GTCTTTTCCTTGGGGAAGCCTGG + Intronic
999444986 5:151632166-151632188 GTGCTGCCCTGGGGGAAGGAAGG - Intergenic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000733588 5:164869078-164869100 TTGCTGTCCTTGCAGAAGGCTGG + Intergenic
1001273541 5:170333532-170333554 GTGCTGGGCTTGGGGAAGCCAGG - Intergenic
1002329094 5:178429256-178429278 GTGCTGGGCTTGAGGTAGACGGG - Intronic
1002836742 6:871086-871108 GTGCTGTCCTGGGGGGAGTTGGG - Intergenic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1003076872 6:2989788-2989810 GTGCTTTCCTTGGGAAAGAACGG + Intronic
1003248292 6:4402379-4402401 GTGGAGTCCTTGGGGGAGCCTGG - Intergenic
1004082742 6:12411314-12411336 GTGGTGCCCTTGGGGAATAGTGG + Intergenic
1004427731 6:15517528-15517550 GTGCAGCCCTTGGGAAAGCCGGG - Intronic
1006298058 6:33178814-33178836 GTGCTGATCCTGGGGAAGCCTGG + Intronic
1010325521 6:74558016-74558038 GTGGTCTCCTTGGGGAAGGATGG + Intergenic
1012730266 6:102872896-102872918 GAGGTCTCCTTGGGGAAGAGTGG - Intergenic
1013627749 6:111954415-111954437 GGCCTGTCCTTTGAGAAGACTGG + Intergenic
1017027176 6:150191611-150191633 CTGCTCTCCTTGTGGAAGATTGG + Intronic
1020687307 7:11311488-11311510 GTGCTCTCCCTAGGGAAGTCTGG - Intergenic
1022036758 7:26542100-26542122 GTGCTGTCCTTGGAGGAGTGGGG + Intergenic
1022385766 7:29897800-29897822 GAGCTTTCCTTGGTGAAGCCTGG + Intronic
1022474476 7:30700990-30701012 GTGCTGTTCTTGGCGGGGACAGG + Intronic
1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG + Intergenic
1023805374 7:43869300-43869322 GTGCTCACCTTGGCGCAGACCGG + Exonic
1030345084 7:108424004-108424026 GTGCTTTCCTTTTGGAAGAGAGG - Intronic
1031316885 7:120269635-120269657 GTGCTGTACTTGTGCAAGACTGG - Intergenic
1031450908 7:121916765-121916787 GTGCTGTCATTGGTCAAGATAGG + Intronic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1031523018 7:122789307-122789329 GTGCTGGCCTTGGGGGAGATAGG - Intronic
1031979420 7:128115202-128115224 GAGCAGTTCTAGGGGAAGACAGG - Intergenic
1033039562 7:137905614-137905636 GTGCTGGCCGTTGGGAAGGCAGG + Intronic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1035326298 7:158068119-158068141 GTGCAGTCCCAGGGGAAGAACGG + Intronic
1035908769 8:3542771-3542793 ATCCTGTCCTGGGGAAAGACTGG - Intronic
1038321576 8:26531944-26531966 TTGGTGTCCTTTGGGAAGACAGG + Intronic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1041314212 8:56544676-56544698 GTGGTTTCCATGGGGAACACAGG - Intergenic
1045265600 8:100616324-100616346 ATGATGTCTTTGGGGAAGGCAGG + Intronic
1049398950 8:142416288-142416310 GGTCTGTCCTGGGGGAAGCCGGG + Intergenic
1049676853 8:143893266-143893288 CTGCTGTCCCTGTGGTAGACAGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051533577 9:18132179-18132201 GTGCTGTCCCCGGGGAAAAAAGG + Intergenic
1051540612 9:18212512-18212534 GTGCTGGTCTTGGAGAAGACTGG + Intergenic
1052850230 9:33373684-33373706 GAGCTGTGTTTGGGGAAGCCAGG - Intergenic
1053206378 9:36190047-36190069 CTGCTGTCCTTAGGGAGGAAAGG + Intergenic
1056307286 9:85302548-85302570 ATGCTGTCCATGGGGCTGACTGG - Intergenic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1060291029 9:122302793-122302815 GTGCAGTCCTTGTGGAAGTTTGG - Intronic
1061575715 9:131504479-131504501 GGGCTGTCCTGGGGACAGACTGG - Intronic
1203663128 Un_KI270754v1:1320-1342 GTGATGTCCTTGCTGAGGACTGG + Intergenic
1186307058 X:8273245-8273267 ATGCTCTCCATGGGCAAGACTGG - Intergenic
1186408821 X:9327789-9327811 GTGATGTGGTTTGGGAAGACAGG - Intergenic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1190373794 X:49768473-49768495 TTGCTGTCCTTAGGGAAGTAGGG + Intergenic
1190916245 X:54813193-54813215 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1190928117 X:54926658-54926680 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1196939264 X:120759681-120759703 GTGCTGTCCTGGGGGATGTAAGG + Intergenic
1198933820 X:141886425-141886447 GAGGTGTCCTTGGGGAAGGATGG - Intronic
1200094203 X:153649715-153649737 GAGCAGGCCTTGGGGAGGACAGG - Intronic