ID: 1127489396

View in Genome Browser
Species Human (GRCh38)
Location 15:59447998-59448020
Sequence CTGTGGGGAGAAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1103
Summary {0: 1, 1: 1, 2: 12, 3: 107, 4: 982}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127489389_1127489396 -1 Left 1127489389 15:59447976-59447998 CCATGGTCAAGCAGTCTTCTCAC 0: 1
1: 0
2: 15
3: 193
4: 1582
Right 1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG 0: 1
1: 1
2: 12
3: 107
4: 982
1127489388_1127489396 0 Left 1127489388 15:59447975-59447997 CCCATGGTCAAGCAGTCTTCTCA 0: 1
1: 0
2: 13
3: 249
4: 2220
Right 1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG 0: 1
1: 1
2: 12
3: 107
4: 982
1127489385_1127489396 19 Left 1127489385 15:59447956-59447978 CCTCATCCATCTTTGCTGGCCCA 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG 0: 1
1: 1
2: 12
3: 107
4: 982
1127489383_1127489396 23 Left 1127489383 15:59447952-59447974 CCTGCCTCATCCATCTTTGCTGG 0: 1
1: 0
2: 1
3: 35
4: 296
Right 1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG 0: 1
1: 1
2: 12
3: 107
4: 982
1127489387_1127489396 13 Left 1127489387 15:59447962-59447984 CCATCTTTGCTGGCCCATGGTCA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG 0: 1
1: 1
2: 12
3: 107
4: 982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127489396 Original CRISPR CTGTGGGGAGAAAGGGAAGA GGG Intronic
900077767 1:832047-832069 GTGTGGAGAGAAACAGAAGAGGG + Intergenic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900560784 1:3305023-3305045 CTGTGTTGAGAAACGGATGATGG + Intronic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
901380511 1:8870639-8870661 TTCTGGGGGGAAAGGGGAGAGGG - Intronic
901595569 1:10382833-10382855 GTTTGGGGAGAAACAGAAGAAGG + Intergenic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901909068 1:12439735-12439757 AGGAGGGAAGAAAGGGAAGAAGG + Intronic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902490144 1:16775530-16775552 ATGTGGGGAGAAACGGGAGAAGG - Intronic
902533422 1:17105062-17105084 CTGTGGGGAGAGATGAGAGAGGG + Intronic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903019978 1:20386991-20387013 ATGGGGGGAGGAGGGGAAGAGGG + Intergenic
903398039 1:23017622-23017644 TTGTGGGGAGAAAGATGAGAAGG - Intergenic
904390816 1:30184618-30184640 GAGGTGGGAGAAAGGGAAGAAGG - Intergenic
904495133 1:30882307-30882329 CTGTGAGGAAAAATGGAAGCAGG - Intronic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904653654 1:32025738-32025760 GAGAGGGGAGAAAGGGAGGAAGG - Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904849987 1:33451457-33451479 CTCAGGGGAGAAAGGGTGGAGGG - Intergenic
904975449 1:34452565-34452587 CTCTGGGGAGAAATGGGTGAGGG + Intergenic
905337688 1:37256752-37256774 CTGTGCAGAGAAAGAGACGAGGG - Intergenic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905446513 1:38031262-38031284 GAGTGGGGAGCAGGGGAAGAAGG - Intergenic
905528846 1:38660596-38660618 CTGTGGGCAGAAATGGAATGAGG + Intergenic
905542940 1:38774537-38774559 CTGTTAAGAGAAAGAGAAGAAGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906033939 1:42739486-42739508 CTGTGGGGAGAAGTGGATGAAGG + Intronic
906205780 1:43985634-43985656 CTCTGGGGAGTAAGGGGTGAGGG - Intronic
906995519 1:50789482-50789504 ATGTGGGATGAAAGAGAAGAAGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907458514 1:54591617-54591639 CTGTGGGGAGGAGGGGCAGGAGG - Intronic
907489532 1:54800312-54800334 CTGGGAGGAGCAAGGTAAGAAGG + Intronic
908151824 1:61310494-61310516 GTATGGGGGGAAAAGGAAGAGGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909345837 1:74585706-74585728 CTGTAGGTAGAAATGAAAGAGGG - Intronic
910503287 1:87919254-87919276 CTGTGGGGAGTAAGGAAGGTAGG + Intergenic
911032135 1:93500445-93500467 CTTTGGGGAGAAAGGAAGGGAGG + Intronic
911170965 1:94770538-94770560 GTTTGGGGAGAAGGGGAGGAGGG + Intergenic
911262114 1:95699107-95699129 CTTTTGGGAGAAAAGCAAGATGG + Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
912501901 1:110128358-110128380 CTGTGGCTAGAACAGGAAGAAGG + Intergenic
912584960 1:110754043-110754065 GTGGTGGGAGAAAGGGAGGAAGG + Intergenic
912619836 1:111144081-111144103 ATGTGGCGAGAAAGGAAAAATGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912705736 1:111910622-111910644 GTGTGCGGAGAAAGTGAAGGGGG - Intronic
913061201 1:115209891-115209913 CTGTGGGGAGAAAGAAATGCAGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913596311 1:120381151-120381173 CTGTGGAGTGATATGGAAGAAGG + Intergenic
913690320 1:121273560-121273582 GAATGGGGAGAAAGGGAAGGAGG + Intronic
914090961 1:144497824-144497846 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914147222 1:145006399-145006421 GAATGGGGAGAAAGGGAAGGAGG - Intronic
914307639 1:146436385-146436407 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914594469 1:149136753-149136775 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915305669 1:154976090-154976112 CTGAGAGGAAAAACGGAAGAGGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915896531 1:159815446-159815468 CCGTGGGGAGAAAGGTGAGCTGG + Exonic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
915972156 1:160362580-160362602 CTGAGGGGAGAAAGGCCAGGCGG + Intergenic
916266346 1:162893273-162893295 CAGAGGAGAGAAAGGGATGAAGG - Intergenic
916346896 1:163802597-163802619 AGGTGGAGAGAAGGGGAAGAAGG - Intergenic
916463931 1:165054268-165054290 GTGTGGGGGGAAAGTGATGAGGG - Intergenic
916721980 1:167491206-167491228 CTGTGGGCGGAAAGGTAAAATGG + Intronic
916840205 1:168592642-168592664 ATGTGGGGGTAAAGGGAGGAAGG + Intergenic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917537263 1:175883511-175883533 CTATGGGGCTAAAGGGATGAGGG - Intergenic
917798946 1:178552953-178552975 GGGTGGGGAGAAAAGGAGGAGGG + Intergenic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918109675 1:181444419-181444441 CTATGGGGGGAAAGGGAGGAGGG + Intronic
918144270 1:181742047-181742069 ATGAGCGGAGAAAGGGGAGAGGG - Intronic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
918863989 1:189870861-189870883 CTTTGGGGAGAAAAGGAATAGGG - Intergenic
919040585 1:192382793-192382815 CTATGGAGGGAAAGAGAAGATGG + Intergenic
919058690 1:192603480-192603502 CTGTTGGAAGAAAGGAAAGTGGG - Intergenic
919239650 1:194896262-194896284 GAGTGGGGAGAATGGGAGGATGG - Intergenic
919394314 1:197025128-197025150 GGGAGGGGAGAAAGGGAAGAGGG - Intergenic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920050355 1:203161153-203161175 TTGAGGAGAGAAATGGAAGAGGG - Intronic
920081147 1:203373683-203373705 TGGGGAGGAGAAAGGGAAGAAGG + Intergenic
920233041 1:204482848-204482870 CGATGGGGGGAATGGGAAGAAGG + Intronic
920477640 1:206292048-206292070 GAATGGGGAGAAAGGGAAGGAGG + Intronic
920827465 1:209435255-209435277 CAGTGGGGAGTAAGGGAATTTGG - Intergenic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
922466289 1:225847275-225847297 CTGTTGGGAGAAGGGCAGGAGGG - Intronic
923275065 1:232388352-232388374 CTCTGGGGAGAAAGAGGAGGAGG + Intergenic
923339533 1:232995842-232995864 TTATAGGAAGAAAGGGAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923517400 1:234709273-234709295 CTGTGTGGAGAATGGGTTGAAGG + Intergenic
923530294 1:234807000-234807022 ATGTGGGGAGAAACGGGAGAAGG + Intergenic
923556647 1:235006060-235006082 CCGTGGGTGGAAATGGAAGATGG + Intergenic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
924554222 1:245104734-245104756 GTGTGGGGAAAAGGGGAAGGAGG - Intronic
924901610 1:248407326-248407348 CTTTGGGGAGAAAAAGAAGCAGG - Intergenic
1062833888 10:623709-623731 CTGAGGGGAGGAGGGGAGGAGGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063217563 10:3938115-3938137 CAGCAGGGAGACAGGGAAGAGGG + Intergenic
1063336628 10:5221931-5221953 CTATGGACAGAAAGGAAAGACGG + Intergenic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1063365188 10:5486336-5486358 CTGCGGGAAGAAAGGGAAGGAGG + Intergenic
1063494477 10:6494269-6494291 CTGTTGGCAGGAAGCGAAGAGGG - Intronic
1063756229 10:9012245-9012267 AGGAAGGGAGAAAGGGAAGAAGG + Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064698165 10:17988840-17988862 CTTAGGGGTGAAAGGGAAAAGGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065207448 10:23370535-23370557 CTTGGGAGAGAAAGGGGAGAGGG + Intergenic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1066440197 10:35431326-35431348 GTGGGGGGAGGAGGGGAAGATGG - Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067672312 10:48334222-48334244 CTTAGGGGACAAAGGAAAGAGGG - Intronic
1067701377 10:48575553-48575575 TGGTGGGGAGAAAGTCAAGATGG - Intronic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1068840804 10:61611786-61611808 GGGAGGGGAGAAGGGGAAGAAGG + Intergenic
1068933185 10:62612270-62612292 CTGTGTGGAGAAAGGATTGAAGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069809230 10:71146179-71146201 CTGTGGGGAGAATAGGTAGGAGG - Intergenic
1069842892 10:71351051-71351073 GTTTGGGGGCAAAGGGAAGAAGG - Intronic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070495226 10:77015337-77015359 CTGTGGGGTCAAGGGGAAGGAGG - Intronic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070735419 10:78860729-78860751 GGGTGGGGAGAATGGGAAGAAGG + Intergenic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071270760 10:84005186-84005208 ATGTGAGGGGAAAAGGAAGAGGG + Intergenic
1071495016 10:86162226-86162248 CAGGGAGGAAAAAGGGAAGAGGG + Intronic
1071534707 10:86418530-86418552 CGGAGGGGAGGAAGGAAAGAAGG + Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072512360 10:96140205-96140227 ATGTGGGGAGTAAGGGATGGAGG + Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072610444 10:97014159-97014181 CTGTGCGGGGAAGGGGAGGATGG + Intronic
1073317440 10:102592906-102592928 GAGAGGGGAGAAAGGGAAGGGGG + Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073618431 10:105022239-105022261 CTGTGGGGTGACAGGGCATATGG + Intronic
1074446648 10:113526108-113526130 CCATGGGGAGAAAGGGGACAGGG + Intergenic
1074579435 10:114704641-114704663 GGGTGGGGAGAAAGAGAAAACGG + Intergenic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075850818 10:125585443-125585465 CTTGGGGGAGAAAGGGGAGAAGG - Intronic
1075935682 10:126339130-126339152 GTAAGGGTAGAAAGGGAAGATGG - Intronic
1075987894 10:126803813-126803835 CGGTGAGGGGAAAGGGAAGGAGG - Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1077223383 11:1427118-1427140 CTGTGGGGAGAGAGGGGATGGGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077269590 11:1669224-1669246 CTGTGGGGCACACGGGAAGAGGG + Intergenic
1077556160 11:3227131-3227153 CTGTGGGGAGACAGGGCTGCAGG + Intergenic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079236341 11:18693376-18693398 CTGTAAGCAGAAAGGGCAGAAGG + Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079645009 11:22852230-22852252 CTGGGAGGTGAAAGGCAAGATGG - Intronic
1080737731 11:35033337-35033359 TTGAGGGCAGAAAGGAAAGAGGG - Intergenic
1080897504 11:36458855-36458877 CTGTGGGGAGAAAGGGAGTGGGG - Intronic
1080928248 11:36781116-36781138 TTGAAGGGAGAAAGGGTAGATGG - Intergenic
1081657650 11:44868086-44868108 CTGTGGGGAGATGGAGAAAAAGG + Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082791269 11:57348084-57348106 CTGATGGGGGGAAGGGAAGAGGG + Intronic
1083140770 11:60719425-60719447 CTGGGGTGAGAAGGGGGAGAAGG - Intergenic
1083179400 11:60974546-60974568 CTAGGGTTAGAAAGGGAAGAAGG - Intronic
1083372222 11:62191200-62191222 CTGTGGGGAGAATTTGGAGAGGG - Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083677579 11:64335147-64335169 CTGTGGGGAGGAGGGGAGGCTGG - Intergenic
1083743088 11:64721478-64721500 CTTTTGGGAGACAGGGGAGAAGG - Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1083989532 11:66238352-66238374 CTCTGGGGATAAAGGGCTGAAGG - Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084110838 11:67013407-67013429 CTGCAGGGAGAAAGGGGAGAAGG - Intronic
1084137714 11:67199199-67199221 CTGAGGAGAGAAAGAGAACAAGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084958925 11:72706038-72706060 CTGTGGGGAGCAAGAGTACACGG - Intronic
1085026763 11:73240852-73240874 CAGTGGGGAGAAAGGGTTTAAGG - Intergenic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085456336 11:76667546-76667568 CTGAGGGGAGCCAGGGAATAGGG - Intronic
1085482905 11:76837595-76837617 CTCGGGGGAGATGGGGAAGAGGG - Intergenic
1085705981 11:78787084-78787106 CTGTGGGGAGGAGCAGAAGAAGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1087250701 11:95896049-95896071 CTGGGGAGAGCAAGGGGAGAGGG - Intronic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1088144049 11:106652907-106652929 CTGTGGGGGAAAAGGTAAGCAGG - Intergenic
1088409091 11:109513678-109513700 CTCTGGGGAGACAGTGTAGATGG + Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088940373 11:114448156-114448178 CTGTGGGAAGAAAGTTAACACGG - Intronic
1088987079 11:114918572-114918594 CTCTTTGGAGAAGGGGAAGATGG + Intergenic
1088993626 11:114976797-114976819 CTTTGGGTAGAAAGAAAAGAAGG + Intergenic
1089548588 11:119251154-119251176 AGGTAGGGAGTAAGGGAAGAAGG - Intronic
1089868526 11:121652348-121652370 AAGTGGGGAGAAAGGGGGGAAGG - Intergenic
1090229078 11:125088855-125088877 CTGTGGGGAGAGTAGAAAGAGGG + Exonic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090552906 11:127842316-127842338 GTTTAGGGAGAAAGGGAAGAAGG - Intergenic
1090776149 11:129967889-129967911 CTGTGGGGTGAAGGGCATGATGG - Intronic
1090878759 11:130814975-130814997 CTGTGCGGGGAAATGCAAGAAGG + Intergenic
1091154420 11:133360594-133360616 CGGAGGGGAGAAAGGGGAGGAGG + Intronic
1091204298 11:133809097-133809119 AGCTGGGGAGAAAGTGAAGACGG - Intergenic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091215591 11:133899494-133899516 TTGGGGAGGGAAAGGGAAGATGG - Intergenic
1091250400 11:134139498-134139520 ATGGAGGGAGAAAGGGCAGAAGG + Intronic
1091347856 11:134867224-134867246 CTGGGGGGATAAAGGCAGGAGGG + Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093062392 12:14620713-14620735 GGGTGGGGAGAAAGGGAATGGGG + Intronic
1093334168 12:17880270-17880292 CTGTTGGTAGAAATGGAAAATGG + Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1095168083 12:38998384-38998406 CAAGGGGGAGAAAGGGAAGGGGG - Intergenic
1095199666 12:39368606-39368628 TTGGAGGGTGAAAGGGAAGATGG + Intronic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095590899 12:43902579-43902601 CTGTGGGGAGACAAGGGATAGGG + Intronic
1095786023 12:46109770-46109792 CTGAGGGGTGAATGGGAAGTGGG + Intergenic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1097014046 12:55972992-55973014 GTGTGTGGAGAAAGTGAAGTAGG - Intronic
1097058688 12:56266791-56266813 CTGTGGCGAGAAAGGGCACTGGG - Intergenic
1097506811 12:60483996-60484018 CCATGGGGTGAAAAGGAAGAAGG - Intergenic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1098334305 12:69386642-69386664 ATGTGGGGAGAGAGGGTATAGGG + Intronic
1098658555 12:73065315-73065337 CTGTTGTGAGAAGGGGAAAAAGG + Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1102268122 12:111506649-111506671 CCGTGGGGAGAAGGAGAAGGAGG - Intronic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102588619 12:113940722-113940744 CTCTGGTGAGAAAGGGATGCAGG - Intronic
1102615492 12:114150545-114150567 CTTTGGGGAGAATGGGATAAAGG - Intergenic
1102706069 12:114881616-114881638 CTCTGGGGTGAAAGGGAGGAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103159619 12:118717998-118718020 CTGGGGTGAGAAAGGGGAGGAGG - Intergenic
1103216773 12:119207773-119207795 ATTTGGGGAGAAAGGGATGTGGG - Intronic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1103995817 12:124829352-124829374 CTGTGGGGAGAACGGGGCGGGGG - Intronic
1104452462 12:128881905-128881927 CTGAGGGGAGAAATGGAAATAGG - Intronic
1104577328 12:129979873-129979895 CTGGAGGATGAAAGGGAAGAGGG + Intergenic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1105669862 13:22601013-22601035 ATGTGTGGAGACTGGGAAGAGGG - Intergenic
1106184409 13:27396456-27396478 CTTTGGGGAGAAAAAGAATAAGG + Intergenic
1106468625 13:30035388-30035410 CAGTGAAGAGAAAGGGGAGAGGG - Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1107080731 13:36372173-36372195 GTGTGGGCAGAAAGGGAGGTAGG - Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1107419195 13:40230775-40230797 CTGTGGGGAGATAGTAAAAATGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108633106 13:52305871-52305893 ATATGGGGAGAAAGAAAAGAGGG - Intergenic
1108653585 13:52506689-52506711 ATATGGGGAGAAAGAAAAGAGGG + Intergenic
1109181531 13:59219961-59219983 CAGAGGGGAGGAAGGGAGGAAGG + Intergenic
1109215218 13:59582392-59582414 CTGTGGGCAGAAAAGGAGTAAGG - Intergenic
1109316949 13:60760976-60760998 GAGTGGGGAGATTGGGAAGAGGG - Intergenic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1110471548 13:75865661-75865683 CTTTGGGGAGGAGGGGAAAAAGG - Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111926338 13:94467324-94467346 CTGTTATGAAAAAGGGAAGAAGG - Intronic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112394745 13:99019443-99019465 ATGTGGACAGAAAGGGATGAAGG - Intronic
1112732334 13:102378289-102378311 CTGTGGGGGCAAAGGGTATAAGG + Intronic
1113831135 13:113296905-113296927 GCGAGGGGAGAAAGGGCAGACGG - Intergenic
1113938083 13:114005726-114005748 CGGAGGGGAGAAAGGGATGGGGG - Intronic
1114053393 14:18943084-18943106 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1114109166 14:19458842-19458864 CTTTGAGGAGAAAAGCAAGATGG - Intergenic
1114296235 14:21331654-21331676 CTGCTAGGAGAAGGGGAAGAGGG + Intronic
1114492841 14:23113964-23113986 CTGTGGGGAGACACTGCAGAGGG - Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1115649759 14:35394526-35394548 CTGTGGGGACCATGGGTAGAGGG + Intergenic
1115729482 14:36252980-36253002 CTATGGGTGGAAGGGGAAGAGGG + Intergenic
1115730271 14:36260956-36260978 ATGTGGGGAGAAATGGAAGGTGG + Intergenic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116064502 14:39965513-39965535 TTGTGGGGAGAAAGATAATATGG - Intergenic
1116195657 14:41722588-41722610 GAGTGGGGACAAAGGGAAAAGGG - Intronic
1116416627 14:44685350-44685372 CTGAGGGAAGAAGGGAAAGAAGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116947475 14:50849047-50849069 TTGTGGAGAGAAAGGGGACAAGG - Intergenic
1116974862 14:51104969-51104991 CTCAGGAGAGAAAGAGAAGATGG - Intergenic
1117051804 14:51867689-51867711 CTGTGGGGACAAAGTGTGGAAGG - Intronic
1117827521 14:59719044-59719066 CTGTAGGGAGAAAGAGTTGAAGG - Intronic
1118000631 14:61519690-61519712 CTGTGAGGAGAAATGGCATAGGG + Intronic
1118075278 14:62291472-62291494 TTGGAGGGGGAAAGGGAAGAAGG - Intergenic
1118636217 14:67750965-67750987 TTGTGGGGAGCAAGGGATAAAGG + Intronic
1118653157 14:67919393-67919415 TTTAGGGGAGAAAGGGAGGAGGG - Intronic
1118739315 14:68727588-68727610 GTGTAGGGGGAAGGGGAAGAGGG - Intronic
1119203228 14:72774402-72774424 CTGTTGGTAGAAATGGAAAATGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119610313 14:76056326-76056348 CTGTTGGGAGAAAAGGGAGAGGG + Intronic
1120159675 14:81131786-81131808 CTATGGGGAAAAGGGGAACAGGG - Intronic
1120384218 14:83823719-83823741 CTCTGGTGAGAAGAGGAAGAGGG - Intergenic
1120608104 14:86604807-86604829 CAGTGGGGAGAAAGGAAGCAAGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121656668 14:95601993-95602015 CTGTGGAGACAAAGAGAAAAAGG + Intergenic
1121688902 14:95860629-95860651 GGGTGGGGAGAAAGGAAAGAAGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122324784 14:100875626-100875648 GAGGGGTGAGAAAGGGAAGATGG - Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122837290 14:104436504-104436526 CTGTGGTGGGAATGGGAACAGGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124651940 15:31480503-31480525 GAGCAGGGAGAAAGGGAAGAAGG - Exonic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125618131 15:41034333-41034355 CCCTGGGGAGTAAGAGAAGAAGG + Intronic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126202483 15:46002894-46002916 CTGTGGGGAGCAAAGGCACAAGG - Intergenic
1126785394 15:52174450-52174472 CTGTGGGAGGAAGGGGAAAATGG + Intronic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127230385 15:56985958-56985980 GAGTGGACAGAAAGGGAAGAGGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127513385 15:59666247-59666269 TTTTGGGGAGCAGGGGAAGAAGG - Intronic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127595292 15:60475891-60475913 ATGTGTGGAGAAAGGAATGAAGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128311584 15:66634316-66634338 CTGGAGGTAGAAAGGGAAGCGGG + Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129233248 15:74208482-74208504 CTGTGGTCAGCAAGGGAACAAGG - Intronic
1129244314 15:74270427-74270449 CTGTCGGGAGACACGGCAGAGGG + Intronic
1129706230 15:77796054-77796076 CTGTGGGGAGAAAGAAGAGGTGG + Intronic
1129756704 15:78103226-78103248 CTAAGGAGAGAAGGGGAAGAAGG - Intronic
1129879557 15:78997885-78997907 GGGTGGGGAGAGAGGAAAGAAGG + Intronic
1130303729 15:82699348-82699370 CTGTGGGGAGAAAGAGGTCAAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130962512 15:88672059-88672081 GAGTGGGGAGGAAGGAAAGATGG + Intergenic
1130994998 15:88898793-88898815 CTATGGGGAGAAAGGGAGCGAGG - Exonic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131912246 15:97220220-97220242 CAGAGGGGAGCAGGGGAAGAAGG - Intergenic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132561092 16:594330-594352 TTGTGGGGAGAAACGGAGGGAGG + Intronic
1132697899 16:1210108-1210130 CTGTGGGGAGAAGAGGTAGAGGG - Exonic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1133286849 16:4694510-4694532 CGGTGGGGAGGAAGGGATGGGGG + Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1133964810 16:10523000-10523022 CTGTGGGTAGACAGGGAACTGGG + Intergenic
1134516858 16:14894468-14894490 CTATTGGGAGAAAGGGAGAATGG + Intronic
1134704528 16:16293122-16293144 CTATTGGGAGAAAGGGAGAATGG + Intronic
1134963014 16:18418992-18419014 CTATTGGGAGAAAGGGAGAATGG - Intronic
1134967309 16:18501591-18501613 CTATTGGGAGAAAGGGAGAATGG - Intronic
1135324599 16:21518506-21518528 CTTTGGGGAGAAGGGGGAGGGGG - Intergenic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136119767 16:28125014-28125036 TCGAGGGGAGAAAGGGAGGAGGG + Intronic
1136336086 16:29611776-29611798 CTTTGGGGAGAAGGGGGAGGGGG - Intergenic
1136342713 16:29655421-29655443 CTATGGGGAGAAAGCAAGGAGGG + Intergenic
1136577052 16:31131172-31131194 CTGTGGGGAGAAGGGGCGGGAGG - Exonic
1137496845 16:48976161-48976183 ATGGAGGGAGAAGGGGAAGAAGG + Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137781190 16:51099086-51099108 CAGTGGTGAGAAATGGATGAGGG - Intergenic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1138165895 16:54801294-54801316 CTCTGGGGAGAAATGCCAGATGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138606541 16:58093762-58093784 CTGGGGAGAGAACGGGATGAGGG - Intergenic
1139377451 16:66509073-66509095 AGGTGGGGGGAAAGGCAAGAGGG - Exonic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1140181437 16:72722951-72722973 ATGAAGGGAGAAAGGGAAAATGG + Intergenic
1140731865 16:77863761-77863783 ACCTGGGGGGAAAGGGAAGAAGG + Intronic
1141105716 16:81232059-81232081 ATGTGGGGAGAATGGGATGAGGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1142763350 17:2053585-2053607 CTATGGGGAGACATGGGAGAGGG + Intergenic
1142946828 17:3436559-3436581 ATTTGGGGAGAAAGGGAACGAGG + Intergenic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143278313 17:5731106-5731128 CCTGAGGGAGAAAGGGAAGAAGG - Intergenic
1143295526 17:5868896-5868918 TTGTGGGGAGAATGGGATCAAGG + Intronic
1143405581 17:6675229-6675251 CCGTGTGGAGAAAGGGCAGTTGG - Intergenic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144697553 17:17315475-17315497 CTTTGGGTAGAATGGGAAGCTGG + Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146531838 17:33614051-33614073 CTGTTGGTAGAAAGGCAAAATGG - Intronic
1147131898 17:38414792-38414814 CTGTAGGGAAAAAGAGAGGAGGG + Intergenic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147470201 17:40651333-40651355 CTGTGGGAAGAAACGGGTGATGG + Intergenic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148510837 17:48168292-48168314 CTTTTGGGAAAAAAGGAAGAAGG + Intronic
1148638719 17:49169027-49169049 GTCTGGGGAGAAAGGGGAAAGGG - Intronic
1148808106 17:50274340-50274362 CTGGGAGGAGGAAGGGAGGAAGG - Intronic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1148955160 17:51347579-51347601 CTGTGGTGAGAAAGGACAGGTGG - Intergenic
1148977535 17:51542803-51542825 GTGTGGGGAGACATGGGAGAAGG - Intergenic
1149141331 17:53436356-53436378 CTGGTGGGAGAAGGGGAAGAAGG - Intergenic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1151578712 17:74965556-74965578 TTGTGGGGAAAAGGGGAAGGGGG - Intronic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152565817 17:81099905-81099927 CTGTGGAGGGAAAGGGAGAAAGG - Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153098842 18:1440740-1440762 TTGTGGGGAGATAGGAAAAAAGG + Intergenic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1155029453 18:21971603-21971625 TTTTTGGGAGACAGGGAAGAGGG - Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1156111571 18:33733407-33733429 AGGTGTGGAGAAAAGGAAGAGGG - Intronic
1156460399 18:37318455-37318477 TTCTGGGGAGAAGGGGAAGGGGG - Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157254443 18:46125867-46125889 CACTGAGGAGAAAGGAAAGAAGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157452318 18:47798261-47798283 CTGTGGGGAGGAGAGAAAGAAGG - Intergenic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157844872 18:50993832-50993854 CTGGGGGGAGAAAGGACAGCAGG + Intronic
1158313201 18:56181475-56181497 CTGTAGGAAGAAATGGAAAAAGG + Intergenic
1158454666 18:57595494-57595516 CTGTGGAGGGAAAAAGAAGAGGG - Intergenic
1158865630 18:61635573-61635595 CTGGAAAGAGAAAGGGAAGAAGG - Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159825387 18:73202341-73202363 CTCTGGGGAGCAAGGGGAGTAGG - Intronic
1159904698 18:74078644-74078666 CTGTGAGGAGAAAGAGGAAAGGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161257349 19:3316675-3316697 CTGTGGGGAGAAAGGGTGGCTGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161316324 19:3619243-3619265 CTGTGGGGAGCAGGGGAAGGTGG + Intronic
1161415726 19:4145432-4145454 AGGTGGGGAGGAGGGGAAGAGGG + Intergenic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162660339 19:12163538-12163560 CTGTGGAGAGAAAAGGAACTGGG - Intronic
1163023277 19:14495224-14495246 CTCTGGGGAGAAGGGAAAGGAGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163499099 19:17664877-17664899 GAGAGGGGAGAAAAGGAAGATGG + Intronic
1163633363 19:18427875-18427897 CTGTGGGCCAAAGGGGAAGATGG - Intronic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164656543 19:29925987-29926009 CTGGGGGGAGGAAGGGATGGTGG + Intronic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164744092 19:30598916-30598938 AGGGAGGGAGAAAGGGAAGAAGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1164828947 19:31305613-31305635 TTGTGGATAGAAAGAGAAGAGGG + Intronic
1164924994 19:32123772-32123794 CTGTGGGGAGATGGGGAAACAGG - Intergenic
1165212965 19:34250189-34250211 CTTTTAGGTGAAAGGGAAGAAGG - Intergenic
1165397813 19:35576773-35576795 CTGTGGGGGTAAAGGCAAGCTGG + Intergenic
1165765175 19:38346043-38346065 CTCTGGAGAGAAATGGAACAGGG + Intronic
1165793590 19:38506280-38506302 CTGAGAGGACAAGGGGAAGATGG - Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166040359 19:40198582-40198604 CTCTGGGGAGTAAGGGAGGGAGG + Intronic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166976283 19:46606985-46607007 TTGAGGGGAGAAAGGAGAGAAGG - Intronic
1167044198 19:47040421-47040443 CTGGGGGGTGACAGAGAAGAGGG - Intronic
1167117277 19:47495595-47495617 CTCTGGAGAGAAAGGGAGGTGGG + Exonic
1167372298 19:49090443-49090465 CTGTCAGGAGAAAGGGGAGGTGG - Intronic
1167486513 19:49766356-49766378 GTGGAGGGAGAAAGGGAACACGG + Intergenic
1167579086 19:50331534-50331556 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579098 19:50331574-50331596 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579110 19:50331614-50331636 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167623203 19:50569900-50569922 CTCCGAGGAGAAGGGGAAGAGGG - Intergenic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
924998555 2:385934-385956 CTGTGGGAGGAAAGGGGAGCAGG - Intergenic
924998782 2:387068-387090 CTGTTTGGAGAAAGTGAAGGGGG - Intergenic
925053574 2:836294-836316 TTGAGGGGAGAAAAGGATGAGGG + Intergenic
925513614 2:4654612-4654634 TTGTCGGGGGACAGGGAAGAAGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925604994 2:5650515-5650537 CTGTGGAGTGATATGGAAGAAGG + Intergenic
925741424 2:7008654-7008676 CAGTCAGGAGAAAGGGAAGCAGG - Intronic
926137061 2:10343821-10343843 ATGAGGGCAGAAAGAGAAGAGGG + Intronic
927422395 2:22947351-22947373 CTATGGGGAGAAATGCAAGTTGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928046647 2:27940940-27940962 ATGTGGGGAGAAACAGAAGTCGG - Intronic
928055899 2:28054287-28054309 GTAGGGGGAGAAAGAGAAGAAGG - Intronic
928219995 2:29395592-29395614 CTTGGGGGAGAAAGGGGAGCAGG - Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929108197 2:38384365-38384387 CTGTGGGGAAAATGAAAAGATGG - Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929720298 2:44361328-44361350 GCGGGGGGAGAAAGGGGAGAAGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930365775 2:50437593-50437615 CTGTGGGGAGAAGAGAAGGAAGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931493422 2:62775025-62775047 CTATGGAGAAAAAAGGAAGAGGG + Intronic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931899737 2:66774507-66774529 TTGTGGGGGGAAAGAGAAGGAGG - Intergenic
932177007 2:69611989-69612011 CTTGGGGGAGAAAGGGAATAGGG + Intronic
932320265 2:70817113-70817135 CTGGAGGGAGGAAGTGAAGAAGG + Intronic
932420025 2:71596191-71596213 CTGGGGGGAGAACGGGGAGGGGG - Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932753994 2:74392149-74392171 CGGAGGGGAGAAAGCGCAGAAGG + Intergenic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
934145925 2:89093934-89093956 CTGTGTGGAGAAAAGGACTATGG - Intergenic
934223333 2:90106634-90106656 CTGTGTGGAGAAAAGGACTATGG + Intergenic
934532865 2:95106458-95106480 CTGTAGGGAGAAAAGAAACAGGG + Intronic
934557374 2:95294586-95294608 CTGTGGGGAGAAACTGAGGCTGG - Intergenic
935002103 2:99028606-99028628 GTGAGGGGAGTAGGGGAAGAAGG - Intronic
935383372 2:102476685-102476707 CGGTAAGGAGAAAGAGAAGAAGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936542551 2:113363961-113363983 GTGTGGGGAGGAACTGAAGAAGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937242447 2:120471045-120471067 GTGTGGAAAGAAAGGGCAGAGGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937345155 2:121120963-121120985 CTGTGGGGAGAACTGGGGGAGGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
937992558 2:127672691-127672713 CTGTGTGGAGAAAGGGCTGCTGG - Intronic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938099624 2:128489823-128489845 CTGCCAGGAGAAAGGGAGGAAGG - Intergenic
938278444 2:130048620-130048642 CTTTGGGGAGAATGGGAGGAGGG + Intergenic
938329419 2:130439479-130439501 CTTTCGGGAGAATGGGAGGAGGG + Intergenic
938360529 2:130682024-130682046 CTTTCGGGAGAATGGGAGGAGGG - Intergenic
938436932 2:131288732-131288754 CTTTCGGGAGAATGGGAGGAGGG - Intronic
938580480 2:132641424-132641446 CAGTTGGGGGAATGGGAAGAGGG + Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
942349270 2:175036071-175036093 CAGTGGGGAGAAAAGAAGGAAGG + Intergenic
942799469 2:179860385-179860407 CTGTGGGGAGAAGGGAGAGCTGG - Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943338407 2:186646663-186646685 CTGTGGGGAAAAAAAGAGGAGGG - Intronic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
943581077 2:189684250-189684272 GTGTGGGGTGAACAGGAAGAAGG - Intronic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
944916907 2:204370247-204370269 CTGTGGGGAGGAGGGGGAGGTGG - Intergenic
945129982 2:206560410-206560432 ATGTGGGGAGAAGGGCAAAAGGG + Intronic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945239401 2:207662377-207662399 CAGAGGGCAGAAAGGGAAAAGGG - Intergenic
945885396 2:215370596-215370618 CTGAGGAGAGAAATGGAACAAGG + Intronic
946395714 2:219442721-219442743 CAGTGAGGAGAAGGAGAAGATGG - Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
947481085 2:230500645-230500667 CTGTGGGGAGAAGGGAGAGTTGG + Intronic
947745731 2:232506454-232506476 GTGGGGAGGGAAAGGGAAGAAGG + Intergenic
947778578 2:232735839-232735861 CTTTGGGGAAAAAGGAAGGAGGG - Intronic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948381398 2:237552314-237552336 CTTTGGGGAAAACAGGAAGAGGG - Intronic
948383852 2:237569401-237569423 CTGTCAGGGGATAGGGAAGAGGG + Intergenic
948871842 2:240804528-240804550 CTGTGGGGGGAATGGGAGGCAGG + Intronic
1169143223 20:3237714-3237736 CCCTAGGGAGAAAGGGAAGCAGG + Intronic
1169197338 20:3690265-3690287 CTGTGGGGAGGAAGGGAGTGTGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169448067 20:5688764-5688786 CCGTGGGGAGGACGGGAAAAGGG - Intergenic
1170101918 20:12710909-12710931 CTGTGGGGAGAAAGGGAGAGAGG - Intergenic
1170396181 20:15927840-15927862 CTTTAGGAAGAAAGGAAAGAAGG - Intronic
1170604042 20:17862830-17862852 TTATGGTGAGAAAGGGAGGAAGG + Intergenic
1170819840 20:19747630-19747652 CTGTAGGGAGAAAGGATAGCAGG - Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171400782 20:24871975-24871997 CTGTGCGCAGAAGGAGAAGAAGG + Intergenic
1172149533 20:32780276-32780298 GGGTGGGGTGAAAGGGAAGCAGG - Intronic
1172203753 20:33147368-33147390 AGGAGGGGAGAAAGGGAGGAAGG + Intergenic
1172275104 20:33674919-33674941 CTGTGTGGAGAACGGGTTGAAGG - Intergenic
1172384365 20:34523279-34523301 CTGTGGGGAGAAGGGACAGCAGG - Intronic
1172758379 20:37304403-37304425 ATGTGGGAAGGAAGGGAATAGGG - Intronic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173036843 20:39419897-39419919 ATGCTAGGAGAAAGGGAAGAGGG + Intergenic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1175245031 20:57577095-57577117 ATGTGGGGAGAGTGGGTAGATGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175889335 20:62309474-62309496 CTCTGGGGGCACAGGGAAGATGG + Exonic
1175998537 20:62821898-62821920 GTTGGGGGAGAAAGGGAAAAGGG - Intronic
1176124210 20:63468244-63468266 CTGTGGGAAGAAGGGGAATGTGG + Intronic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177381354 21:20348169-20348191 GTGAGAGGAGCAAGGGAAGATGG + Intergenic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178446506 21:32648267-32648289 GTTTGGGGGGAAAGAGAAGAGGG - Intronic
1178799489 21:35779160-35779182 CTGAGAGGAGAAGGGGAAGCGGG + Intronic
1179160551 21:38893509-38893531 ATGTGGGGAGAAAAAGGAGAAGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179501748 21:41813468-41813490 CTCTGGGGAGCAGGGGAGGAAGG + Intronic
1179894752 21:44355203-44355225 CTGTGGGGAGGAGGGGCAAAGGG - Intronic
1179902406 21:44401016-44401038 CCGTGAGGAGAAAGGGAAGGAGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1180305044 22:11067087-11067109 CTGTGGGGGAAAGGGGAAGGTGG + Intergenic
1180471862 22:15665459-15665481 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181995318 22:26875769-26875791 GTGTGGGGAAAAAAGAAAGATGG - Intergenic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1182299888 22:29331449-29331471 CTTTGTGGAGGACGGGAAGATGG - Exonic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182617448 22:31597267-31597289 CTCTGGAGAAAAAGGGCAGAGGG + Intronic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183581905 22:38731347-38731369 CTGTGGGCTTAAAGGGAAAAAGG - Exonic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1185212364 22:49577476-49577498 CTGTGGGGAGAGAGGGACTGTGG - Intronic
1185219773 22:49623500-49623522 CTGTGGGGAGAAGGCCAGGACGG - Intronic
950134268 3:10569712-10569734 CTCTGGGGTGAAAGTGAAGGAGG + Intronic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950434152 3:12968357-12968379 CTGGGTGGAGAAAGGGTAGGGGG - Intronic
950468022 3:13166957-13166979 ATGTGGGGAGAAAAGCGAGAGGG + Intergenic
950499621 3:13355355-13355377 CTGTGGAGAGAAAGGGAATGTGG - Intronic
950504269 3:13384297-13384319 CTTTGGGGAGAAGCGGCAGAGGG + Intronic
950528923 3:13541191-13541213 GTGCTGGGAGAAGGGGAAGAAGG + Intergenic
951171545 3:19547752-19547774 TTGAAGAGAGAAAGGGAAGAGGG - Intergenic
951458054 3:22915591-22915613 CTGTTGGGAGAAATGTAAGTGGG - Intergenic
951617195 3:24560431-24560453 CTGTGAGGGGAAATGGAAAAAGG + Intergenic
952467026 3:33599773-33599795 GTGAAGGGAGAAAGGGAAGGAGG + Intronic
952593208 3:34982687-34982709 GTGTGTGGGGTAAGGGAAGAGGG - Intergenic
953436982 3:42885439-42885461 TTGTTGGGGGAAAGGGAATAGGG + Intronic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955166227 3:56516548-56516570 GAAAGGGGAGAAAGGGAAGAAGG + Intergenic
955320000 3:57967639-57967661 CTGAGGGGCAAAAGGCAAGAAGG + Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956436208 3:69236956-69236978 GGGTGGGTAGAAAGTGAAGAGGG - Intronic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
956921852 3:73938127-73938149 CCATAGGGAGACAGGGAAGAAGG + Intergenic
957620460 3:82586116-82586138 CTGTGGGGAAAATGAAAAGATGG - Intergenic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
959143659 3:102517263-102517285 GTGAGGGGACAAAGAGAAGATGG + Intergenic
959181615 3:102987466-102987488 GTGAGGGGAGAAAGAGGAGATGG + Intergenic
959369995 3:105511421-105511443 CTTTGAGGAGAAAGGAGAGATGG - Intronic
959633933 3:108540315-108540337 TGGTGGAGAGAAAGGGAACATGG - Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960683727 3:120275776-120275798 CTGTGAGGAGAAAGGAAGGGAGG - Intronic
960737495 3:120796772-120796794 CTCTGGGGAGAAATGGTACATGG - Intergenic
961006521 3:123409374-123409396 ATGTGGGGAAAAAGGACAGACGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
962304917 3:134277642-134277664 ATGTGAAGAGAAAGGGAAGGAGG + Intergenic
962878521 3:139554313-139554335 CTGGAGGGAGAAAGGAAAGCTGG - Intergenic
962902604 3:139774353-139774375 CTGATGGGAGAAACAGAAGAAGG - Intergenic
962929343 3:140022671-140022693 CTGTGTGGAGAATGGGATGGAGG + Intronic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
963258468 3:143169792-143169814 CACTGGGGAGAAAGGCATGATGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964180643 3:153880341-153880363 AGGTGTGGAGAAAGGTAAGAGGG + Intergenic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
964427615 3:156569715-156569737 ATGAGGGGGGAAAGGGAAGCAGG + Intergenic
964574636 3:158151484-158151506 TTCAGGGGAGAAGGGGAAGAGGG + Intronic
965486336 3:169283159-169283181 ATTTAGGGAGAAAGGGATGAGGG + Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966657403 3:182374781-182374803 TTTTGGAGAGAAAAGGAAGAGGG - Intergenic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
969143477 4:5100340-5100362 CTGGGGGGAGGAAGGAAGGAAGG - Intronic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969314132 4:6371388-6371410 CTGTGGGGAGCAGGGGAGGCAGG - Intronic
969392749 4:6901979-6902001 CTGGAGGGAGACAGGCAAGAAGG + Intergenic
969492529 4:7508181-7508203 ATGTAGGGAGGAAGGGAAGGGGG + Intronic
969933580 4:10658584-10658606 CTTTGGGGAGATAGGGAGGCTGG - Intronic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970616284 4:17771257-17771279 CTGTGTGGAGAAAGGATAGGAGG + Intronic
970742888 4:19258300-19258322 CTGTGTGGAGAAGGGGCACATGG + Intergenic
970764561 4:19532014-19532036 TTGTGGAGACAAAGGAAAGAAGG + Intergenic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
971454120 4:26828002-26828024 CTATGGGGTTAAAGGGTAGATGG + Intergenic
971740258 4:30510513-30510535 CAGTAGGGAGAAAAAGAAGATGG - Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974351797 4:60757316-60757338 CTGTTGGTAGAAAGGTAAAATGG + Intergenic
974568193 4:63606935-63606957 CTGTGGGGAGAATGAGAAACAGG - Intergenic
974794534 4:66731626-66731648 CTGTGGAGAGCAAGGGTAAAAGG - Intergenic
974916208 4:68182172-68182194 GTGTGGGGAGAAAGTTAAGTAGG - Intergenic
975008234 4:69317681-69317703 CTGTGAGGAGAAAAGGAACATGG - Intronic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975612975 4:76219611-76219633 CTGAGGGGAGAAAGGGGGGATGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976361519 4:84184018-84184040 CTATGGGATGAAAGGGTAGAAGG - Intergenic
976472670 4:85447814-85447836 CTGCCAGGAGAAAGGGAGGAAGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977293949 4:95191880-95191902 AGGAGGGGAGAAAGGGAGGAGGG - Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978431584 4:108638779-108638801 CTGTGGAGAGGAAGGGACCAAGG - Intergenic
978549862 4:109913968-109913990 GAGTGGGGAGAAAGTGAAGGAGG - Intronic
978697118 4:111595816-111595838 GTTTGGGGAGAAATGGAAGGAGG - Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
980469799 4:133236350-133236372 CTGTTGTGAGAAAAGAAAGAAGG + Intergenic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
982233279 4:153228871-153228893 TTGTGGGGGGAAAAGGATGAAGG - Intronic
982266697 4:153544499-153544521 GTGTGAGGGGTAAGGGAAGAGGG - Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982720523 4:158855048-158855070 CTTTGGGGAGAAAGAGGAGTAGG + Intronic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
983135170 4:164070114-164070136 AAGTGGGGAGAAAGGGAGAAGGG + Intronic
983268882 4:165538070-165538092 CTGTGCGTAGCAAGAGAAGAGGG - Intergenic
984144450 4:176044206-176044228 GTGGGGGGAGAAGGGGTAGAGGG + Intergenic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985364947 4:189219386-189219408 CTGAAGGAAGAAAGGAAAGAAGG + Intergenic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
985552727 5:541623-541645 CTGTGAGGAGCAGGGGAAGGTGG - Intergenic
985589018 5:755265-755287 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985603698 5:847781-847803 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985733031 5:1561511-1561533 ATGTGGGGATAAGGGGAAGGCGG + Intergenic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
986260565 5:6142384-6142406 CTGTGAGGGGTAAGGGAAGCAGG + Intergenic
986565658 5:9111165-9111187 CTGTGGGTAGAAGGAGAAGTAGG + Intronic
987027190 5:13939514-13939536 CTGTGGGAAGACAGGGAAACAGG - Intronic
987368631 5:17172772-17172794 CTATGGGGAGAAACACAAGATGG + Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988490391 5:31700712-31700734 CTGAGGAGGAAAAGGGAAGAAGG + Intronic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
988968830 5:36445679-36445701 CGGCACGGAGAAAGGGAAGAAGG - Intergenic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989219199 5:38936221-38936243 ATGTGAGGAGAAAGCGAACAGGG - Intronic
989604124 5:43227629-43227651 CTGAGGGGAGAAAGGGAATTGGG + Intronic
989789608 5:45381532-45381554 ATGTGAGGAGTAAGGGACGAGGG - Intronic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990287549 5:54314879-54314901 CACTGGAGAGAAAGGGAAAAAGG - Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991127881 5:63088089-63088111 CTGGGAAGAGAAGGGGAAGATGG + Intergenic
991362095 5:65831507-65831529 CTTTGGGGAGAAAGGAAGGGTGG - Intronic
992132598 5:73708344-73708366 AGGTGGGGAGAAAGGGAGGGAGG - Intronic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992865301 5:80951801-80951823 CTGTGGCCAGAAGGGGAAAAAGG + Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993511881 5:88780836-88780858 ATGTAGGGAGAAAGAGAAGGGGG - Intronic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995512155 5:112921109-112921131 CTGCGGGGAGGAATGGAGGAAGG + Intronic
995704921 5:114978505-114978527 GTGTGGGGGAAATGGGAAGAGGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996450777 5:123621668-123621690 AAGTGGGGAAAAAGGCAAGAAGG - Intergenic
996885959 5:128353985-128354007 CAGTGGGGAGACAGGGAGGGAGG - Intronic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997258619 5:132448321-132448343 TTGTGGGGAGATAAGGAATACGG - Intronic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
997640620 5:135446531-135446553 CTGTTAGGAGAAAGTGAAGGTGG + Exonic
997662628 5:135601126-135601148 CTGTGGGGAGGAAGTGACTAGGG + Intergenic
998102411 5:139445352-139445374 CTATGAGGAGTAAGGGAAGTAGG + Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998318816 5:141210029-141210051 CTCTGGGGACAACGGAAAGATGG + Exonic
998608870 5:143666027-143666049 CTCAGGGGGGAAAGGGCAGATGG + Intergenic
998988358 5:147787475-147787497 TTGTGGGGTGAAATGGAAGCAGG + Intergenic
999379011 5:151106931-151106953 GTGGGAGGAGAAAGGGAAGAGGG + Intronic
999401407 5:151267178-151267200 CTGTTTTGAGAATGGGAAGAGGG + Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000209833 5:159098794-159098816 AAGGGGGGAGAAAGGAAAGAAGG + Intronic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1001214902 5:169846548-169846570 TTGTGGTGAGAAAGGGAGCATGG + Intronic
1001319560 5:170669032-170669054 CTGTGATGAGAAAGAGAAGCAGG - Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001651324 5:173318194-173318216 CTGTGGGGAGGAGGTGAAGGAGG - Exonic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002959604 6:1901908-1901930 CAGAGGGGAGACAGGGAAAAGGG + Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005048669 6:21665075-21665097 GGATGGGGAGAAAGGAAAGAGGG + Intergenic
1005119953 6:22378978-22379000 ATGTGGGGAAAAGGGCAAGAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005824552 6:29624925-29624947 CAGTGGGGAGCCAGGGCAGAGGG + Intronic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1005951368 6:30633798-30633820 GGGTGGGGAGAAAGAGGAGAAGG + Intronic
1006067050 6:31469599-31469621 CAGTGGGGAGAAAGGACAAAGGG + Intergenic
1006361229 6:33588569-33588591 CTGAGGGCAGTAAGGGGAGATGG - Intergenic
1006401482 6:33820487-33820509 CTGTGGGGTGACAGGGATCACGG + Intergenic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1006950083 6:37814676-37814698 CGACGGGGAGAAAGGGAGGAGGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007530731 6:42539863-42539885 CTGTGGGGAGACAGGGAGTTGGG - Intergenic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007831004 6:44638273-44638295 CTGTGGGGAGAAAGGGACAGGGG + Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008802648 6:55388901-55388923 CTGGGGGAAGAACAGGAAGAGGG - Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010766571 6:79782139-79782161 GTGGGAGGTGAAAGGGAAGAAGG - Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011576581 6:88807086-88807108 CTGTGGGGGGCATGGGGAGAGGG + Intronic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012242282 6:96887371-96887393 CTGTGAGGAAAAAGGTAACAAGG - Intergenic
1012629184 6:101442256-101442278 TTGTTGGGAGAAAAGGAAAAAGG + Intronic
1013282289 6:108649689-108649711 TTGTGGATAGAAAGGGAAGTAGG - Intronic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013367842 6:109448444-109448466 CTGAGGGGAGGAAGGGCAGCAGG + Intronic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1013855703 6:114569518-114569540 CTGTGGGTAGAAATGTAAAATGG - Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015122478 6:129714834-129714856 CTGTCCAGAGAAAGGGAAAAGGG - Intergenic
1015301825 6:131661319-131661341 CTGTTGGTAGAAAGGCAAAACGG - Intronic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015749142 6:136542737-136542759 CTGTGGGGAAAAAAGAATGAAGG + Intronic
1015771580 6:136773581-136773603 ATCTAGTGAGAAAGGGAAGATGG - Intronic
1015912233 6:138180480-138180502 TAGTAGGGAGAAAAGGAAGAAGG - Intronic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016150141 6:140730412-140730434 ATGTGGGGAGTAAGGCAGGATGG + Intergenic
1016231208 6:141806631-141806653 TTCTGGGGAGAACGGAAAGAGGG - Intergenic
1016363433 6:143291600-143291622 CTGGCGGGGGAAATGGAAGAAGG - Intronic
1016675127 6:146756274-146756296 CTCTGGGGAGAATGGTAGGAAGG - Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017676094 6:156815460-156815482 GTGTGGGGAGAAAGGGAGAAAGG - Intronic
1018366312 6:163123305-163123327 CTGTGGTGACAAGGAGAAGAGGG + Intronic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019340581 7:507134-507156 CTGAGGGGACAAAGGTCAGAGGG - Intronic
1019690698 7:2409657-2409679 CGGAGGTGAGAAAGGGAAGCAGG + Intronic
1019762885 7:2826776-2826798 TTGAGGGGAGACAGGGAAGGAGG + Intronic
1020331161 7:7018150-7018172 ATGCGGGGAGAAAGGGAATCAGG + Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021012816 7:15492770-15492792 AGGTGGGGAGAAAGAGAAAAAGG + Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021402790 7:20228835-20228857 CTTTGGGGATAATGGAAAGAGGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021799213 7:24287322-24287344 CTGTGGTGGGAAGGAGAAGATGG - Intronic
1021839134 7:24708016-24708038 CTGTAGGGAGAAAAGGAGGCGGG + Intronic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1023039621 7:36160756-36160778 CTCTGGGGAGATGGGGAAGTGGG + Intronic
1023168175 7:37363614-37363636 CTGGGCGTAGAAAGGGAAAATGG - Intronic
1023267148 7:38418649-38418671 TTGGAGGGAGAAAGGGAAAAAGG - Intronic
1023666147 7:42525343-42525365 ATGTGGGGAGAAAGGGGAAGAGG + Intergenic
1024549944 7:50554305-50554327 CTGTGGGGGGCAGGGGGAGAGGG + Intronic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025048692 7:55715474-55715496 CTAGGAGGAGAAAGAGAAGAGGG - Intergenic
1026159099 7:67852969-67852991 CTGGAGGGAGAAGGGGATGAGGG + Intergenic
1026206013 7:68258117-68258139 GAGTGGGGAGACAGGGAATAAGG + Intergenic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028439001 7:90837614-90837636 CTGTGGGGAGAAAGACATGTTGG + Intronic
1028465546 7:91147605-91147627 CTGTTAGGAGAAAGGCAACATGG - Intronic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030729542 7:112969715-112969737 GAGTGGGGAGAAATGGAAAAAGG - Intergenic
1030772540 7:113492145-113492167 GTGTGGCAAGAAAGGGAAAAGGG - Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031051498 7:116950324-116950346 AGGCGGGGAGAAGGGGAAGAAGG - Intergenic
1031070541 7:117156588-117156610 ATGTGGAGAGATAGAGAAGAGGG + Intronic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1031886407 7:127250485-127250507 ATGTGGGGAGAAATAGATGACGG - Intronic
1031923915 7:127620438-127620460 CTTTCCGGAGAAAGAGAAGAAGG - Intergenic
1032207761 7:129883596-129883618 CTGTGGGGAGCCAGGGCAGGCGG + Intronic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1033599057 7:142876145-142876167 CTGGGGGCTGAAAGGGAAGGTGG + Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1034928847 7:155144359-155144381 ATGTGGGGTGAAGGGGAGGAGGG + Intergenic
1035527854 8:327590-327612 GTGTGGAGAGAAACAGAAGAGGG - Intergenic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1035861622 8:3034921-3034943 CACTGTGGAGAAAGGGAAGGAGG + Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036190038 8:6661852-6661874 CTGTGTGGGGAAAGGGCTGATGG + Intergenic
1036654627 8:10670226-10670248 GTGTGTAGAGAAAGGGGAGAAGG + Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037161664 8:15780684-15780706 CTGGGGTGAGCCAGGGAAGAGGG - Intergenic
1037370277 8:18170007-18170029 ATGTTGGGGGAATGGGAAGATGG + Intergenic
1037424537 8:18741147-18741169 TGGTGGGGAGAAAGGAAGGAAGG + Intronic
1037445312 8:18959598-18959620 GTGTGGGCAGAAAGGCAAGGTGG - Intronic
1037578187 8:20227820-20227842 TTCTGGAGAGAAAGGGGAGATGG - Intergenic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1037962815 8:23111697-23111719 CTGTGGGGACAAAGGAGTGATGG - Intronic
1038492591 8:27981491-27981513 GTGAGGGGAGACAGGGAAGCTGG - Intronic
1038780056 8:30562424-30562446 CTGTGGGGAGCAGGTGAGGAAGG + Intronic
1038852225 8:31290756-31290778 CTGTTGGGGGAAAGGGGAGTTGG - Intergenic
1038911796 8:31973055-31973077 TGGTGTGGAGAATGGGAAGAGGG - Intronic
1038969363 8:32614896-32614918 CTGAGGGGTGAAAGAGTAGAAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039847882 8:41338657-41338679 CAGTGGGGAGAAAGAAAAAAGGG + Intergenic
1040105736 8:43540735-43540757 CCGTCGGGAGAATGGGAGGAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1040795678 8:51288222-51288244 AAGAGGGGAGAAAGGGAAGGGGG - Intergenic
1041030294 8:53729598-53729620 CTGTGGGGAGGAAGGGAGTGTGG + Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041171855 8:55150598-55150620 CTGAGCAGAAAAAGGGAAGAAGG - Intronic
1041577131 8:59411213-59411235 TTATGGGGAGCAAGGGAGGATGG + Intergenic
1041697360 8:60750033-60750055 CTATGGGGTGAAAGGACAGATGG - Intronic
1041880486 8:62744090-62744112 CCTTGGGGAGAAAGGAAAGCAGG + Intronic
1042020546 8:64369300-64369322 CTCTAGGGAGAAAGGGGAGGGGG + Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043178202 8:77048137-77048159 GGGTGGGGAGAAAGGGGAGGGGG + Intergenic
1043285959 8:78531766-78531788 TTGTGGAAAGAAAGGGAAGGAGG + Intronic
1043869265 8:85413111-85413133 ATGCAGGAAGAAAGGGAAGAAGG - Intronic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044842297 8:96346836-96346858 ATGAGGGGAGAAAGGGACCAGGG - Intergenic
1045139780 8:99267762-99267784 TTCTGGGGAGAAAGTGAAGCTGG + Intronic
1045244584 8:100431827-100431849 GAGAGGGGAGGAAGGGAAGAAGG - Intergenic
1045344121 8:101279480-101279502 CAATGGGGAGCAGGGGAAGAGGG - Intergenic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1045855913 8:106765378-106765400 CTGTATGGAGAAAGTGAAAATGG + Intronic
1046344877 8:112910441-112910463 TTGTAGGGGGAAATGGAAGAAGG - Intronic
1046409892 8:113827971-113827993 CTGAGAAGAGAAAGGGTAGATGG - Intergenic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1048224497 8:132571591-132571613 GAGAGAGGAGAAAGGGAAGAAGG + Intergenic
1048308183 8:133297784-133297806 CTGTCGGGCGAAAGCGAAGGCGG - Intronic
1048319133 8:133385124-133385146 CTGGGGTGAGAAAGAGGAGAAGG - Intergenic
1048518606 8:135133511-135133533 CTGTGGTGAGATGGGGAAGGAGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1049348990 8:142154076-142154098 CTGTGGGGAGAGCTGCAAGAGGG - Intergenic
1049451796 8:142666007-142666029 CAGAGGGGAGAAGCGGAAGAGGG - Exonic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1049764955 8:144350878-144350900 CCCTGGGGAGAAAGGAAAGGGGG - Intergenic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050567259 9:6899227-6899249 ATGTGGGGAGAAGGGGAATATGG - Intronic
1050710909 9:8462177-8462199 AAGTGAGGAGGAAGGGAAGAAGG - Intronic
1051250400 9:15153017-15153039 CTGAGTGGGGAAAGGGAAAAAGG - Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051825670 9:21215857-21215879 ATGTGGGGAGCAAGCGGAGAGGG - Intronic
1051826500 9:21226732-21226754 ATGTGGGGAGCAAGTGGAGAGGG - Intronic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1052049830 9:23831885-23831907 CTGTGAGGAGAAGTGGAAAAGGG + Intergenic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1053030318 9:34770713-34770735 TTAGGTGGAGAAAGGGAAGAGGG + Intergenic
1053055998 9:34993431-34993453 GTATGGGGAGGAAGGTAAGAGGG + Exonic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053450691 9:38191989-38192011 ATGTGGGGAGAAGGGAAAGGAGG - Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055101202 9:72467489-72467511 CTGTGGGAAGAAAGAACAGAGGG - Intergenic
1055402807 9:75942356-75942378 GTGTTGGGAGAAAGGGAGAAAGG + Intronic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058337006 9:103842403-103842425 CTATGGGGAGAAAAGGAAACTGG - Intergenic
1058603854 9:106699940-106699962 CTGAAGGGAGCATGGGAAGAGGG - Intergenic
1058913150 9:109539727-109539749 ACCTGGGGGGAAAGGGAAGACGG - Intergenic
1059221109 9:112619552-112619574 TTTTGGGGGGAAAGGGTAGAAGG + Intronic
1059269230 9:113061584-113061606 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059270366 9:113067033-113067055 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059271502 9:113072483-113072505 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059272633 9:113077927-113077949 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059273768 9:113083369-113083391 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059274902 9:113088815-113088837 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059427614 9:114231054-114231076 GTGGGGAGAGAAAGAGAAGAGGG - Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060529830 9:124341666-124341688 CTGTGGAGAGACAGGGAGGCAGG - Intronic
1060536134 9:124389596-124389618 CTGTGGAGAGACAGGGAGGCAGG + Intronic
1060862432 9:126965821-126965843 CTGTGGAGAGCAGGGAAAGATGG - Intronic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061362705 9:130153836-130153858 CTGTTGGGAGAATAGGAGGAGGG + Intergenic
1061594832 9:131622054-131622076 CTGTGGGAAGAATGGGGGGAGGG - Intronic
1061719684 9:132543884-132543906 CCGTACGGAGAAAGGGAAGTGGG + Intronic
1061725015 9:132577462-132577484 AGGAAGGGAGAAAGGGAAGAGGG + Intergenic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1062283932 9:135764790-135764812 GTGTGGGGACCAAGGGAGGAGGG - Intronic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1188601633 X:31973527-31973549 CAGTGGGGAGAAGAGGAGGATGG - Intronic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1189269052 X:39737477-39737499 CTGTAGGGAGACAGAGGAGAGGG - Intergenic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1189904058 X:45739499-45739521 GTGTGGGGAGTAAGGGAAAATGG + Intergenic
1190034484 X:47008761-47008783 CTGGGAGGAGACAGGGAAGCAGG + Intronic
1190534622 X:51413548-51413570 ATGGAGGGAGAAAGAGAAGAGGG - Intergenic
1190738277 X:53269982-53270004 GTGTGGAGTGAAAGAGAAGAGGG - Intronic
1190862925 X:54360564-54360586 CTGTAGGCAGAAAGGGGAGCGGG + Intergenic
1190942649 X:55057141-55057163 CTGTGGTGGGAAAGGGGAGAGGG + Intergenic
1191752285 X:64555896-64555918 AGGTGGGGAGAATGGGAGGAGGG + Intergenic
1191796402 X:65026189-65026211 CTTTGGGGAGGAAGGAATGAAGG + Intronic
1191836269 X:65466666-65466688 CTGTTGGGAGAAATGGAAATTGG - Intronic
1191982336 X:66940150-66940172 CTGAGGTGAGAAAGGGTAGTGGG - Intergenic
1192164483 X:68818787-68818809 AGGTGGGGAGAAAGGGAGGGGGG + Intergenic
1192243900 X:69357844-69357866 CAGTGGGGAGAAAGGCAGGCTGG - Intergenic
1192547118 X:72023358-72023380 CCTTGGGGAGAAATGGGAGAAGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193266459 X:79476930-79476952 CTGTTGGGGGAAATGGGAGAAGG - Intergenic
1193527515 X:82611903-82611925 CTCTGGGGAGGAATGGAAGGTGG + Intergenic
1194250040 X:91563093-91563115 CCGAGGGGAGAGAGGCAAGAAGG - Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197502364 X:127257504-127257526 GTGTTGGGAGAAAGGAAAAATGG + Intergenic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198370226 X:135982817-135982839 CTGGGGGGAGAAAGAAAGGATGG + Intergenic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198546966 X:137702399-137702421 GTGTGGGGAGCTAGAGAAGAGGG - Intergenic
1199223533 X:145344340-145344362 CAATGGGGAGAAAGGCATGATGG - Intergenic
1199253527 X:145692670-145692692 CTGTGGGGTGAAAAAGAAGAAGG - Intergenic
1199503855 X:148539618-148539640 TTGGGTGGGGAAAGGGAAGAGGG - Intronic
1199834881 X:151579678-151579700 TTATTGGGAGAAAGTGAAGATGG + Intronic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200820509 Y:7577882-7577904 AGGAGGGGAGAAAGGAAAGAAGG + Intergenic
1201558730 Y:15292225-15292247 GAGGAGGGAGAAAGGGAAGAAGG + Intergenic