ID: 1127505797

View in Genome Browser
Species Human (GRCh38)
Location 15:59596587-59596609
Sequence GCAAACCTTTAGTAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127505797_1127505802 -2 Left 1127505797 15:59596587-59596609 CCTTCCACCTACTAAAGGTTTGC 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1127505802 15:59596608-59596630 GCGGATGATGAGCTGACAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1127505797_1127505801 -3 Left 1127505797 15:59596587-59596609 CCTTCCACCTACTAAAGGTTTGC 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1127505801 15:59596607-59596629 TGCGGATGATGAGCTGACAAAGG 0: 1
1: 0
2: 3
3: 8
4: 75
1127505797_1127505804 19 Left 1127505797 15:59596587-59596609 CCTTCCACCTACTAAAGGTTTGC 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1127505804 15:59596629-59596651 GGTAGATTAATAGGAGAAAAAGG 0: 2
1: 14
2: 27
3: 77
4: 360
1127505797_1127505803 10 Left 1127505797 15:59596587-59596609 CCTTCCACCTACTAAAGGTTTGC 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1127505803 15:59596620-59596642 CTGACAAAGGGTAGATTAATAGG 0: 1
1: 5
2: 86
3: 227
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127505797 Original CRISPR GCAAACCTTTAGTAGGTGGA AGG (reversed) Intronic
901287354 1:8091494-8091516 GCACATCTGTAGTAGGTGGGAGG - Intergenic
901806612 1:11742777-11742799 CCAACACTTTAGGAGGTGGAGGG - Intronic
901815296 1:11790200-11790222 GCCCACCTCTAGGAGGTGGAAGG + Exonic
903656339 1:24950815-24950837 GCAGACCTGTAGTAGGTGGAAGG + Intronic
904776466 1:32911201-32911223 GAAAACCAGTAGTAGCTGGAGGG - Intergenic
906861540 1:49365978-49366000 GCATACTTTTAGCAGCTGGAAGG + Intronic
907017610 1:51032490-51032512 GCAAACCTTAACTAGGTAGCTGG + Intergenic
907743799 1:57192391-57192413 GCATACATCTAGTAAGTGGAAGG - Intronic
908483472 1:64567123-64567145 GCATACCTCTAGTAAGTGGTAGG + Intronic
910301756 1:85713973-85713995 GAAAACCCTTAGGAGGTGAAAGG - Intergenic
915351256 1:155227747-155227769 GCACACCCTTAGTGGGTGGGGGG + Intergenic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
916986679 1:170199403-170199425 GCAAACCTTTAGAGAGTGAAGGG - Intergenic
917346424 1:174032811-174032833 CCAAAACTTTATTATGTGGAGGG + Intergenic
920533736 1:206723729-206723751 GCATACCTTGAATAGGGGGAGGG + Intronic
920994818 1:210979205-210979227 ACAAAGCTGTAGTAGGAGGAGGG + Intronic
923971842 1:239211964-239211986 GCAAATCTTTAGTATTTGAATGG - Intergenic
1064786660 10:18905155-18905177 GTAAGCCTTGAGTAGGTGAATGG + Intergenic
1068992144 10:63161209-63161231 TCCAACCTTTAGCAGGTGGCTGG - Intergenic
1074048845 10:109864661-109864683 GCAGACATTTCCTAGGTGGAAGG - Intergenic
1075353030 10:121743252-121743274 GGAAACCTTAAGTATGGGGAAGG - Exonic
1075864881 10:125709223-125709245 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
1076267209 10:129118284-129118306 GCAAACCCTTGGTGGGTGGATGG - Intergenic
1079869410 11:25778547-25778569 GCACAGCTCTAGTAGGTGGTGGG + Intergenic
1080103593 11:28487874-28487896 GCAAACATTTACTAAATGGAGGG + Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1083286419 11:61662053-61662075 GCAAACCTTCAGTGGGTGAAGGG + Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1085426765 11:76411625-76411647 GCAAACCTTTATCAAGGGGAAGG + Intronic
1086508716 11:87532116-87532138 GCAAACCTTCAGATGGTGAAGGG + Intergenic
1087770877 11:102208414-102208436 GCGAACCTTTAGAGGGTAGAGGG + Intronic
1089691216 11:120187796-120187818 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1093825598 12:23683600-23683622 GGAAACCTTTAGTATGTAAATGG + Intronic
1099367606 12:81788322-81788344 GCAAACCTTCAGTAATTTGAAGG - Intergenic
1104482152 12:129117008-129117030 GATATCCTTTAGTAGGTGAATGG + Intronic
1106972087 13:35153466-35153488 GCAAACATTTAGCAGAGGGAGGG + Intronic
1107322953 13:39209033-39209055 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1108554644 13:51581272-51581294 GGGAACCTCTAGTAGCTGGAGGG - Intergenic
1111485153 13:88888047-88888069 GTAATCCTTTTGTTGGTGGAGGG - Intergenic
1112229535 13:97574387-97574409 GCAAACGTTTAGAAGATTGATGG - Intergenic
1112888599 13:104204972-104204994 GCAAATCTTTAATGGGGGGAGGG - Intergenic
1113157864 13:107345838-107345860 CCAACCCTTTATTGGGTGGAGGG + Intronic
1114233502 14:20804123-20804145 GCAAACCTTTGGAGGGTGAAAGG + Intergenic
1116932131 14:50701524-50701546 GCAGACCTGTAGGAGGTGGCTGG + Intergenic
1118899681 14:69975889-69975911 GAGAACCTTTAGAAGGTTGATGG + Intronic
1124009320 15:25824061-25824083 GCAAATTTTTAGTAAGTGGTGGG - Intronic
1125088371 15:35759280-35759302 GCCAACCTTTAGTTGTAGGAGGG + Intergenic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1127505797 15:59596587-59596609 GCAAACCTTTAGTAGGTGGAAGG - Intronic
1128154600 15:65384792-65384814 CCAAAGGTTGAGTAGGTGGAGGG - Intronic
1130116653 15:81011076-81011098 GCAAACATTTACTAGGTGTCTGG + Intronic
1134369477 16:13609677-13609699 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1134443278 16:14312025-14312047 GCAAACTTTTAGCGGGTGAAGGG - Intergenic
1135846858 16:25926793-25926815 GCAAACCATCAGTGGCTGGAAGG - Intronic
1136776360 16:32873919-32873941 GCAAACCTTCAGGAGGGGGTGGG - Intergenic
1136894255 16:33987593-33987615 GCAAACCTTCAGGAGGGGGTGGG + Intergenic
1141708020 16:85680002-85680024 GCAGACTTGTAGGAGGTGGACGG - Intronic
1203078775 16_KI270728v1_random:1136028-1136050 GCAAACCTTCAGGAGGGGGTGGG - Intergenic
1148387692 17:47246639-47246661 GATATCCTTTAGTAGGTGAATGG + Intergenic
1150128473 17:62653447-62653469 GCCTGCATTTAGTAGGTGGAGGG + Intronic
1151095584 17:71493901-71493923 ACAGTCATTTAGTAGGTGGATGG + Intergenic
1153321191 18:3775696-3775718 GCAAACCTTCAGAGGGTGAAGGG + Intronic
1155244107 18:23890986-23891008 GTAAACCTTCTGTAGGTGAAGGG - Intronic
1155752884 18:29451631-29451653 GATGTCCTTTAGTAGGTGGATGG + Intergenic
1156683958 18:39621911-39621933 GCAAACCTTTAGAGGGCAGAGGG + Intergenic
1157059481 18:44271076-44271098 GCAAACCTTTAACAAGTTGAGGG - Intergenic
1159058332 18:63489512-63489534 GCAAACATTTATGAGATGGAAGG - Intronic
1166458801 19:42968054-42968076 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1166475748 19:43123325-43123347 GCAAACCTTCAGAGGGTGAAGGG - Intronic
925302905 2:2829636-2829658 CCAAACCTTTAGTACGTAGTGGG + Intergenic
925637208 2:5951775-5951797 GCAAGCCTTTAGAAAATGGAGGG + Intergenic
928738082 2:34315924-34315946 GTGAACCTTTAGAAGGTGAAAGG + Intergenic
929729729 2:44475217-44475239 GGAAACTTTTAGTAAGTGGTTGG + Intronic
929766472 2:44848043-44848065 GCCTACCTTTAGCAGATGGAGGG + Intergenic
930714917 2:54584505-54584527 CCACACCTTCAGTAGGTGAAAGG + Intronic
931689356 2:64822215-64822237 GCAAGCCTTTAGAGGGTGAAGGG + Intergenic
932058748 2:68473392-68473414 GATGACCTTTAGTAGGTGAATGG - Intronic
932820573 2:74896246-74896268 GAAAACCTTCAGAGGGTGGAGGG + Intergenic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
933352595 2:81173950-81173972 GATACCCTTTAGTAGGTGAATGG - Intergenic
942623740 2:177876844-177876866 GCAAACCTTCAGAGGGTAGAAGG - Intronic
943211269 2:184969885-184969907 GCAAACCTTCAGAAGGCGAAGGG + Intergenic
945451590 2:210001367-210001389 GCAAACCTTTGGAGGGTGAAGGG - Intergenic
1173494230 20:43507504-43507526 GCAAACCTGTCCTAGGTTGAGGG + Intergenic
1183349563 22:37327320-37327342 GCAAACATTTTCTAGATGGATGG + Intergenic
949973702 3:9434705-9434727 GGAAACATTTGGTAGGTGGGAGG + Intronic
950108235 3:10401932-10401954 GAGATCCTTTAGGAGGTGGAAGG - Intronic
950854092 3:16089194-16089216 GCAAACTTTTTGGGGGTGGATGG + Intergenic
951223099 3:20089895-20089917 CCAATGCTTTAGGAGGTGGAAGG + Intronic
952826248 3:37527466-37527488 GCAACCCTTTAGTATCTGAAGGG + Intronic
955004330 3:54955020-54955042 GCAAACCTTCAGAGGGTGAAGGG - Intronic
960171170 3:114462692-114462714 CCAAACTCTTAGTAGGTTGAAGG + Intronic
963295928 3:143546576-143546598 GTAAACCTTGAATGGGTGGAAGG - Intronic
963391473 3:144669626-144669648 GCAAACCTTTGACAGGTAGAAGG + Intergenic
964204881 3:154162630-154162652 GCACATCTTTGGGAGGTGGAAGG - Intronic
965415717 3:168389623-168389645 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
966025987 3:175282724-175282746 GAGAACCTTCAGTAGTTGGAGGG + Intronic
966058909 3:175732174-175732196 GCAAACCTTCAGAGAGTGGAGGG - Intronic
967603776 3:191419878-191419900 GCAAACTTTTTGCAGATGGATGG - Intergenic
971586933 4:28416204-28416226 GCAAAACTTTAGAAGGAAGAGGG + Intergenic
973123418 4:46552891-46552913 GCACAGCTTTGGTATGTGGAAGG + Intergenic
974961035 4:68700526-68700548 GTAATCATTTTGTAGGTGGAGGG - Intergenic
980077742 4:128311239-128311261 GGAAATATTTAGTAGGTGGGGGG - Intergenic
981564619 4:146086296-146086318 GCAATCTTTTAGCTGGTGGAGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984494285 4:180475207-180475229 GCACATCTTTGGGAGGTGGAAGG - Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985220961 4:187705071-187705093 GCAAACCTTCAGATGGTGAAGGG - Intergenic
986796956 5:11222145-11222167 ACAAACCTTTTGTGGGTGGGTGG + Intronic
989669075 5:43892632-43892654 GCACATCTTTAGGATGTGGAAGG + Intergenic
990206534 5:53435445-53435467 GCAAACCTTTGGAAGTAGGAGGG - Intergenic
990495887 5:56347398-56347420 GCAAACCTTCAGAGGGTAGAAGG + Intergenic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
996438349 5:123460701-123460723 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
996469714 5:123845424-123845446 TCAACCATTTAGCAGGTGGAAGG + Intergenic
997466282 5:134090180-134090202 GCAAACCTTGGGTAGGTGAGAGG - Intergenic
998402838 5:141856837-141856859 GGAAACCTTGAGAAGGTGGGTGG - Intronic
1002484527 5:179524992-179525014 GGAAGCCTTTGGTAGGTGGGTGG - Intergenic
1002500052 5:179642496-179642518 GGAAGCCTTTGGTAGGTGGGTGG + Intronic
1003731820 6:8832965-8832987 GATATCCTTCAGTAGGTGGATGG - Intergenic
1004033295 6:11894822-11894844 GATATCCTTTAGTAGGTGGGTGG - Intergenic
1005096270 6:22120227-22120249 GCAAACCTTTAAAGGGTGAAGGG - Intergenic
1005115597 6:22332089-22332111 GCAAACCTTTGGGATGTGGAAGG + Intergenic
1005652605 6:27898266-27898288 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1008095670 6:47337023-47337045 GCAGACATGTAGGAGGTGGAGGG + Intergenic
1008454705 6:51696205-51696227 GCAAACCTGTAGCACTTGGAAGG + Intronic
1018570882 6:165208611-165208633 GCACACCTTTGGGATGTGGAGGG - Intergenic
1020683975 7:11270743-11270765 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1021413017 7:20349978-20350000 GCAAATCTTTGGTGGGTGGAAGG - Intronic
1022857627 7:34331169-34331191 GCAAACCTTTCAAAGGTGGATGG - Intergenic
1023168686 7:37368963-37368985 GCAAACCTTCAGGAGATGAAGGG + Intronic
1023379460 7:39592072-39592094 GAAGTCCTTTAGTAGGTGAATGG - Intronic
1024973668 7:55093702-55093724 GGAAACTTTTAGCTGGTGGATGG + Intronic
1029851280 7:103463928-103463950 GCACACCTTTCGTATGTCGAAGG + Intergenic
1031430277 7:121659500-121659522 AGAAACCTTCAGTAGGTGAATGG - Intergenic
1033121425 7:138669868-138669890 GTAAACCTTTGGAAGGTGAAGGG + Intronic
1034047619 7:147946799-147946821 GCTAACCTTTAGAGGGTGAAGGG - Intronic
1038522840 8:28248019-28248041 ACAAACCTTAAGAAGGGGGAAGG + Intergenic
1045369030 8:101502699-101502721 GAAAACCTTAAGTAGGTGAAAGG + Intronic
1047106387 8:121734958-121734980 GTAATCCTTTTGTTGGTGGAGGG + Intergenic
1053537842 9:38943885-38943907 GCAAACATTGAAAAGGTGGATGG - Intergenic
1054628292 9:67420040-67420062 GCAAACATTGAAAAGGTGGATGG + Intergenic
1055005591 9:71502290-71502312 GATATCCTTTAGTAGGTGAATGG + Intergenic
1056549143 9:87636903-87636925 TCAAAACTTTATCAGGTGGATGG - Intronic
1056807864 9:89742833-89742855 GCAAACGTTTTGAAGATGGAGGG + Intergenic
1059089719 9:111342869-111342891 GATGACCTTTAGTAGGTGAATGG + Intergenic
1059219976 9:112606192-112606214 GGAAACACTGAGTAGGTGGATGG + Intronic
1185909852 X:3971415-3971437 GCAAACCTTTTGTAAGTTAAAGG + Intergenic
1188395310 X:29675533-29675555 GAAGAACTTTAGGAGGTGGAGGG + Intronic
1188480006 X:30627785-30627807 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1188537707 X:31215778-31215800 GAAAGCCATTAGTGGGTGGAGGG + Intronic
1188727946 X:33607933-33607955 GCAAACCTCCAGAAGGTGAATGG - Intergenic
1188796471 X:34472262-34472284 GCACAACTTTAGAATGTGGAAGG + Intergenic
1191877033 X:65807613-65807635 ACACACCTGTAGGAGGTGGATGG - Intergenic
1192231430 X:69267755-69267777 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1192239368 X:69317157-69317179 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1192474632 X:71429587-71429609 CCAAACCTTTAGAAGGAGAAAGG + Intronic
1193134245 X:77952089-77952111 GATACCCTTTAGTAGGTGAATGG - Intronic
1194538439 X:95138285-95138307 GCAAACCTTTAGAGGGCAGAGGG - Intergenic
1194757076 X:97749952-97749974 GCAAACTTTCAGAAGGTGAAGGG - Intergenic
1195499254 X:105575331-105575353 GGAACCCATTAGAAGGTGGAGGG - Intronic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1196193426 X:112816939-112816961 GGAAACAATTAGTATGTGGATGG + Intronic
1196279367 X:113804760-113804782 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1197139390 X:123099136-123099158 GAAAAGCTTTAGTAGATGGGTGG + Intergenic
1199645110 X:149901490-149901512 ATAAAGGTTTAGTAGGTGGAGGG - Intergenic