ID: 1127507259

View in Genome Browser
Species Human (GRCh38)
Location 15:59609493-59609515
Sequence GGGGGGTATTTCCAGGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127507259_1127507275 17 Left 1127507259 15:59609493-59609515 CCTATAGCCTGGAAATACCCCCC 0: 1
1: 0
2: 5
3: 57
4: 238
Right 1127507275 15:59609533-59609555 TTTGAGTTGTCCCGTCTTTCTGG 0: 3
1: 46
2: 231
3: 369
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127507259 Original CRISPR GGGGGGTATTTCCAGGCTAT AGG (reversed) Intronic
900033588 1:388902-388924 GAGGGGCGCTTCCAGGCTATAGG - Intergenic
900054423 1:618792-618814 GAGGGGCGCTTCCAGGCTATAGG - Intergenic
901411199 1:9085368-9085390 GGAGGGTTCTTCCAGGCTATAGG + Intronic
902589524 1:17463647-17463669 CGGGGTTGCTTCCAGGCTATAGG + Intergenic
902709601 1:18229758-18229780 GAGGTGTATTTACAGGATATGGG + Intronic
903207015 1:21790139-21790161 AGGGGGTGCTTCCAGGTTATAGG - Intergenic
904387576 1:30154088-30154110 CAGGGGGACTTCCAGGCTATAGG + Intergenic
906313780 1:44772797-44772819 GGGGGAAATCTCCAGGATATTGG + Intergenic
909443229 1:75720873-75720895 GGGGGGAGGTTCCAGGTTATAGG + Intergenic
910401707 1:86843763-86843785 TGGGGAGGTTTCCAGGCTATAGG + Intergenic
910422811 1:87086194-87086216 CTGGGGTATGTCCAGGGTATTGG + Intronic
913173637 1:116254694-116254716 GCGGGGGCTTTCCAGGCCATAGG - Intergenic
916013542 1:160728085-160728107 GGGGGACATTTTAAGGCTATTGG + Intergenic
917670378 1:177268267-177268289 GCTGTGTATATCCAGGCTATTGG - Intronic
918968490 1:191381564-191381586 TGGGGGGACTTCCAGGCTATAGG - Intergenic
919596575 1:199571064-199571086 TGGGGGGCCTTCCAGGCTATGGG - Intergenic
920972681 1:210756171-210756193 GGAGGGTTTCTCCAGGCTATGGG - Intronic
922255946 1:223893057-223893079 GAGGGGCGCTTCCAGGCTATAGG - Intergenic
923706642 1:236349548-236349570 TGGGGGTGCTTCCAGGCTATAGG + Intronic
924337145 1:242995924-242995946 GAGGGGCGCTTCCAGGCTATAGG - Intergenic
1065414234 10:25467144-25467166 GTGGGGGACTTCCAGACTATAGG + Intronic
1065847249 10:29755921-29755943 GGGGGTGGCTTCCAGGCTATAGG - Intergenic
1066685688 10:37979326-37979348 TGGGGGTGCTTCCAGGCTACAGG - Intergenic
1069178639 10:65327247-65327269 GGGGGAGACTTCCAGACTATAGG - Intergenic
1070255590 10:74810989-74811011 ATGGGGTACTTCCAGGCTGTAGG + Intergenic
1070430792 10:76335665-76335687 GGGGGGAGCTTCCAGGTTATAGG + Intronic
1070904831 10:80062860-80062882 GGGGGGTGCTTCCAGCTTATAGG + Intergenic
1071074036 10:81730183-81730205 GGGGGGTGATTCCAGGGTATAGG + Intergenic
1073532996 10:104250028-104250050 GGGAGGTGCTTCCAGGGTATTGG - Intronic
1073548582 10:104375790-104375812 GGGGGGGGCTTCCATGCTATAGG + Intronic
1073867755 10:107824589-107824611 TGGGGGTGCTTCCAGGCTACAGG + Intergenic
1074454487 10:113585659-113585681 GAAGGGTTTTTCCAGGATATGGG - Intronic
1075505495 10:123017803-123017825 GGGGGTGGCTTCCAGGCTATAGG + Intronic
1076652650 10:132000521-132000543 GGGGCGAGCTTCCAGGCTATAGG - Intergenic
1076653581 10:132006347-132006369 AGAGGGCACTTCCAGGCTATAGG + Intergenic
1084186016 11:67471840-67471862 GGGTAGGATTTCCAGGTTATAGG + Intergenic
1084504524 11:69556962-69556984 GGAGGGGATTTCGAGGCTCTAGG - Intergenic
1084801170 11:71545165-71545187 GGGGAGTGCTTCCAGGCTATAGG + Intronic
1084933121 11:72572540-72572562 GCGGGGGGCTTCCAGGCTATAGG + Intergenic
1085281325 11:75332910-75332932 GGGGGGAGCTTCCAGGCTATAGG - Intronic
1086460155 11:86997992-86998014 TGGGGGGACTTCCAGGCTATAGG + Intergenic
1086963671 11:93006308-93006330 AGTGGGGACTTCCAGGCTATAGG - Intergenic
1088948658 11:114541673-114541695 GGATGGTGCTTCCAGGCTATAGG + Intronic
1092076585 12:5678418-5678440 CAGGGGTATCTCCAGGCTCTGGG + Intronic
1092629151 12:10359896-10359918 GGGGGGTAGTTTCAGGCTATAGG + Intergenic
1094588686 12:31801019-31801041 CGGGGGGCCTTCCAGGCTATAGG + Intergenic
1095209632 12:39477192-39477214 GGGGGGGACTTCCAGGTCATAGG - Intergenic
1096049335 12:48593483-48593505 GGAGGGGGCTTCCAGGCTATAGG - Intergenic
1096115532 12:49052678-49052700 TGGGGGTATCGCCAGGCTCTGGG + Exonic
1096562060 12:52442811-52442833 GGCTGGAATTTCCAGGCTAAAGG + Intergenic
1097881156 12:64687825-64687847 GGGGGATATGTCTAGGCTACAGG - Intronic
1099046920 12:77732417-77732439 GGTGGGTGATTCCAAGCTATAGG + Intergenic
1099937092 12:89139340-89139362 TGGATGTATTTCCAGGATATTGG - Intergenic
1100978648 12:100147261-100147283 GAGGGGAGCTTCCAGGCTATAGG - Intergenic
1101505929 12:105346137-105346159 GGGGGTTGTTTCCAGGTGATAGG - Intronic
1103868468 12:124073161-124073183 GGGGGATATTTCTAGTCTAGGGG - Intronic
1104852217 12:131882476-131882498 GGGTGGCATCTCCAGGCTTTTGG - Intergenic
1107680758 13:42847703-42847725 TGGGGCTATTTCCAGCATATAGG + Intergenic
1107915689 13:45147825-45147847 ATGGGGGATTTCCAGGCTAAGGG - Intronic
1108824164 13:54391273-54391295 GGGTGGTATTTACAGGTCATAGG + Intergenic
1110278390 13:73663783-73663805 GGGGTATAATTTCAGGCTATGGG + Intergenic
1110815971 13:79860274-79860296 GGTGGGTGCTTACAGGCTATAGG + Intergenic
1113161940 13:107391734-107391756 GGCGGGTGCTTCCAGGCTATGGG - Intronic
1113390365 13:109890538-109890560 GGGAGTTGCTTCCAGGCTATAGG + Intergenic
1119401852 14:74368097-74368119 ATGGGGTTTTTCCAGGCTATAGG - Intergenic
1120970538 14:90203460-90203482 AGGGGGTACTTCCAGGCCATAGG - Intergenic
1123494401 15:20811042-20811064 GGGGGAAATCTCCAGGATATTGG + Intergenic
1123550898 15:21380133-21380155 GGGGGAAATCTCCAGGATATTGG + Intergenic
1123669720 15:22643704-22643726 GGGGGGGGCTTTCAGGCTATAGG - Intergenic
1124525692 15:30450120-30450142 GGGGGGTGCTTTCAGGCTATAGG - Intergenic
1124772963 15:32557565-32557587 GGGGGGTGCTTTCAGGCTATAGG + Intergenic
1126118041 15:45226702-45226724 GGGGGTGGCTTCCAGGCTATAGG + Intergenic
1126645020 15:50867217-50867239 AGCGGGGGTTTCCAGGCTATAGG + Intergenic
1127101873 15:55574540-55574562 TGTTGGTATTTCTAGGCTATAGG + Intronic
1127507259 15:59609493-59609515 GGGGGGTATTTCCAGGCTATAGG - Intronic
1128314582 15:66652667-66652689 AGGGGGTACTTCCAGGATAAAGG + Intronic
1128469545 15:67940720-67940742 GGTGGGGGCTTCCAGGCTATAGG - Intergenic
1129195536 15:73963514-73963536 AGTGGGGACTTCCAGGCTATAGG - Intergenic
1202959239 15_KI270727v1_random:107377-107399 GGGGGAAATCTCCAGGATATTGG + Intergenic
1133962233 16:10504596-10504618 GGTGGGAATTTCCAGGTCATAGG - Intergenic
1134330184 16:13243443-13243465 TGGGGGGGCTTCCAGGCTATAGG + Intergenic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1135776239 16:25259022-25259044 GGTGGGGGCTTCCAGGCTATAGG + Intergenic
1136518476 16:30781940-30781962 GGGGGGTTTTTCCTGGGTGTGGG + Exonic
1141030586 16:80584414-80584436 GAGGGGTAGTTCCAGGTCATAGG - Intergenic
1141371885 16:83495289-83495311 AGGGTGTGTTTCCAGGTTATAGG + Intronic
1141924371 16:87157963-87157985 GGGGGAAATCTCCAGGCCATTGG + Intronic
1142442893 16:90112202-90112224 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
1142775939 17:2139149-2139171 GGGAGATGTTTCCAGGGTATTGG + Intronic
1143430846 17:6882519-6882541 GGGGGAAATCTCCAGGATATTGG - Intronic
1144696374 17:17306459-17306481 GGGGAGTATGGCCAGGCTATAGG - Intronic
1145024710 17:19459422-19459444 GGGGTGGGGTTCCAGGCTATAGG - Intergenic
1145990179 17:29074611-29074633 AGGGGCACTTTCCAGGCTATGGG - Exonic
1156385581 18:36601904-36601926 GGTGGTTATTTCCAGGATCTAGG - Intronic
1157428743 18:47605816-47605838 GAGGGGGGCTTCCAGGCTATAGG + Intergenic
1157724010 18:49949121-49949143 GGGCAGTATTTCTGGGCTATGGG - Intronic
1158864563 18:61625754-61625776 GTGGGGTGTTTCTAAGCTATAGG - Intergenic
1159769220 18:72528354-72528376 GGGTTGTAATTCCAGGCTCTGGG - Intergenic
1159937969 18:74383562-74383584 TTGGGGGACTTCCAGGCTATAGG + Intergenic
1164147471 19:22520771-22520793 GGGATGTATTTCCAGGCTCCAGG - Intronic
1164159133 19:22615344-22615366 GGGATGTATTTCCAGGCTCCAGG + Intergenic
1165368915 19:35390003-35390025 GGGTGGGGCTTCCAGGCTATAGG + Intergenic
1165471455 19:36006985-36007007 GGGGGGTAACTCCAGGTTTTGGG - Intronic
1167200997 19:48065279-48065301 GGGGGGGGCTTCCAGGTTATAGG + Intronic
1167369186 19:49070830-49070852 GGGGTGGATTTCCAGGCATTTGG + Exonic
1168498211 19:56871915-56871937 GGGCGGTGCTTCCAGGCTATAGG - Intergenic
925800234 2:7591773-7591795 GGGGGCGGCTTCCAGGCTATAGG + Intergenic
926999251 2:18775263-18775285 GGGGGGCACTTTCAGGTTATAGG - Intergenic
927718928 2:25370852-25370874 AGGGGGTGGTTCCAGGCTGTAGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928682220 2:33714225-33714247 TGGGGGGGCTTCCAGGCTATAGG + Intergenic
931317021 2:61142533-61142555 AGCAGGGATTTCCAGGCTATAGG + Intergenic
931418137 2:62100576-62100598 GGGAGGTACTTCCAGGCTATAGG + Intronic
933388595 2:81642867-81642889 GGGGGAAATCTCCAGGATATTGG + Intergenic
935278472 2:101496542-101496564 GGGAGGTGTTTCCAGGCTTCAGG - Intergenic
936677709 2:114734450-114734472 AGTGGGGGTTTCCAGGCTATAGG - Intronic
936706913 2:115086373-115086395 GGGGGTGGCTTCCAGGCTATGGG - Intronic
937551164 2:123094337-123094359 AGGGGGCACTTCCAGGCTATAGG + Intergenic
937622690 2:124007109-124007131 GGTGGGTGTTTCCAGGCTGATGG + Intergenic
938739917 2:134221299-134221321 AGTGGGGACTTCCAGGCTATAGG + Intronic
938875386 2:135526962-135526984 AGTGGGGACTTCCAGGCTATAGG - Intronic
938966436 2:136392769-136392791 GGGGGATGCTTCCAGGTTATAGG + Intergenic
939061788 2:137431223-137431245 GGAGGGGGTTTCCAGGCTATAGG + Intronic
941863619 2:170310732-170310754 GGGGGATGGTTCCAGGCTATAGG + Intronic
943235334 2:185310695-185310717 GAGGGGAATTTCCACGATATGGG + Intergenic
945294211 2:208154817-208154839 GGGGAGGATTTCCCTGCTATTGG - Intergenic
945743169 2:213688105-213688127 GGGGAGGATTTCCAGGCTATAGG + Intronic
945868762 2:215204557-215204579 GGGGGGGATTTCCAGGTTACAGG - Intergenic
946944007 2:224800942-224800964 GAGGGGCACTTCCAGGTTATAGG + Intronic
947020251 2:225666543-225666565 GGGGGATGGTTCCAGGCTACAGG + Intergenic
947164686 2:227249970-227249992 AGGGGCTATTTCTAGGCTCTAGG + Intronic
1170659460 20:18322754-18322776 GGGGTGTGCTTCCAGGCTATAGG + Intergenic
1170794149 20:19532019-19532041 GGGGGTTGACTCCAGGCTATGGG + Intronic
1171261118 20:23735456-23735478 GGGGCATATTTCCAGGCATTTGG - Intergenic
1171270242 20:23811298-23811320 GGGGCATATTTCCAGGCATTTGG - Intergenic
1173934512 20:46849708-46849730 GGTGGGTATGACCAAGCTATGGG - Intergenic
1174296834 20:49551486-49551508 GGGGGGTGCTTCCAGGTTATAGG - Intronic
1175544608 20:59770262-59770284 GGAGGGTAGTTCCGAGCTATGGG + Intronic
1176703775 21:10093271-10093293 GGGGGTTGGTTCCAGGCTATAGG + Intergenic
1177175974 21:17701084-17701106 AGTGGGAACTTCCAGGCTATAGG + Intergenic
1178004511 21:28202515-28202537 TGGGGAAATTTCCAGGTTATTGG + Intergenic
1178866304 21:36330423-36330445 AGCGGGGACTTCCAGGCTATAGG - Intronic
1179460513 21:41531601-41531623 GGAGTGTGCTTCCAGGCTATAGG + Intergenic
1181304800 22:21909574-21909596 GGGGGGCACTTCCAGGCAATAGG - Intergenic
1182521363 22:30886264-30886286 GAGGGGGCCTTCCAGGCTATAGG + Intronic
1183114043 22:35675884-35675906 GGTGGGTGTTTCCAGTTTATAGG - Intergenic
1183211278 22:36452855-36452877 GGGGGGTTCTTCCAGGCAAAAGG + Intergenic
1184091128 22:42293572-42293594 AGGGGGTATCTTCAGGCTATGGG + Intronic
1184322415 22:43752594-43752616 GGGGCATAATTCCAGGCTGTGGG + Intronic
1184630117 22:45770829-45770851 TGGGGGTATTCCCAGGCCATGGG - Intronic
1184848652 22:47104882-47104904 GGGGGTTGTTCCCAGGCGATAGG - Intronic
949318301 3:2781690-2781712 GGGGGGTGCTTCCAGGCTTTGGG + Intronic
949462209 3:4304973-4304995 GGGGGGGGCTTCCAGACTATAGG + Intronic
949497516 3:4646536-4646558 GGGCCATATATCCAGGCTATAGG + Intronic
949811434 3:8011079-8011101 GGTGGGGGTTTCCAGGCTAAAGG + Intergenic
950332688 3:12169028-12169050 TGGTGGTATTTCCAGGATATTGG + Intronic
951300915 3:20995098-20995120 GGTGGGGGTTTCCAGGCTATAGG + Intergenic
951332615 3:21384567-21384589 CGGGGGAGATTCCAGGCTATAGG + Intergenic
952107372 3:30085876-30085898 GTGGGGGGCTTCCAGGCTATAGG - Intergenic
953427382 3:42805918-42805940 GGAGGGGGCTTCCAGGCTATAGG + Intronic
954604235 3:51896292-51896314 GGGCAGTGTTTCCAGGCTACAGG - Intronic
957297059 3:78345922-78345944 GGAGGGGGCTTCCAGGCTATAGG + Intergenic
957842256 3:85686839-85686861 GGAGGGTGCTTCCAGGTTATTGG - Intronic
957925482 3:86805376-86805398 GGGGAGTACTGCCAGGCTACTGG - Intergenic
957961286 3:87256897-87256919 GGGGTGTATTTTCAAGCTGTTGG - Intergenic
957983940 3:87548168-87548190 GAGGGTGAATTCCAGGCTATAGG + Intergenic
960408025 3:117285763-117285785 GGGGTGAATTTCCAGGCTCAAGG + Intergenic
960919290 3:122730275-122730297 TGGGGGTATTTCAAGACTGTCGG - Exonic
963433204 3:145235769-145235791 GGAGGGGGCTTCCAGGCTATAGG - Intergenic
964458740 3:156897544-156897566 GGGGGAGGCTTCCAGGCTATAGG + Intronic
964486513 3:157190816-157190838 GGAGGGGATTTCCAGGTCATAGG - Intergenic
964612735 3:158631250-158631272 GGGGGGCGCTTCCAGGCTGTAGG + Intergenic
964845590 3:161041219-161041241 GGGAGGCATCTCCAGGCTATAGG - Intronic
965180426 3:165395603-165395625 GAGAGGTGCTTCCAGGCTATAGG - Intergenic
967886958 3:194339973-194339995 GGTGGGTGCTTCCAGGCTGTAGG + Exonic
968363165 3:198163162-198163184 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
968924540 4:3540132-3540154 GGGGGGGACTTCCAGGCTATAGG - Intergenic
970944797 4:21678385-21678407 GTGGGCTATATCCAGTCTATTGG - Intronic
971751986 4:30662246-30662268 GGGAGGTGCCTCCAGGCTATAGG - Intergenic
973574190 4:52269570-52269592 GGGGGGAGCTTCCAGGCTATAGG - Intergenic
975029081 4:69591352-69591374 TGGGGGTGCATCCAGGCTATAGG + Intronic
976970778 4:91099675-91099697 GGGGACTGCTTCCAGGCTATGGG + Intronic
977343504 4:95790169-95790191 GGGAGGTGTTTCCAGGCTATAGG + Intergenic
977345490 4:95811577-95811599 AGGGGGTACTTCCAGGTTATAGG - Intergenic
979239979 4:118439381-118439403 GAGGGGCACTTCCAGGCTATAGG + Intergenic
979616779 4:122751846-122751868 GGGGGAAATTTCCAGGACATTGG + Intergenic
980052806 4:128055005-128055027 GGGTGGGGCTTCCAGGCTATAGG + Intergenic
980375989 4:131949623-131949645 GGGGGTTGGTTCCAGGCTATAGG + Intergenic
982202272 4:152972666-152972688 AGGTGGTATTGCCAGGCTCTCGG + Intronic
983141298 4:164152863-164152885 GGGGTGGACTTCCAGGCTATAGG - Intronic
983822771 4:172216928-172216950 GAGGGGGGCTTCCAGGCTATAGG + Intronic
984393274 4:179166176-179166198 GGGTGGGGGTTCCAGGCTATAGG - Intergenic
986646910 5:9925746-9925768 GGGAGGGGCTTCCAGGCTATAGG - Intergenic
987462905 5:18235155-18235177 GGGGAATGCTTCCAGGCTATAGG + Intergenic
987786625 5:22508730-22508752 GGGGGTGGTTTCCAGGCTGTAGG - Intronic
988568052 5:32336231-32336253 GCGGGGGGCTTCCAGGCTATAGG + Intergenic
988633169 5:32952749-32952771 GAGGGGGGCTTCCAGGCTATAGG - Intergenic
990775215 5:59299073-59299095 GGCGGGTATTCAGAGGCTATGGG - Intronic
993983777 5:94573130-94573152 GGGGGGTTGTTCCAGGTTATAGG + Intronic
995823309 5:116263734-116263756 GCGGGGAGCTTCCAGGCTATAGG - Intronic
998646047 5:144063532-144063554 GCGGGGGGCTTCCAGGCTATAGG + Intergenic
1000892133 5:166812708-166812730 GGAGGGTATTTCAAAGCAATAGG + Intergenic
1002740232 5:181429966-181429988 GAGGGGCGCTTCCAGGCTATAGG + Intergenic
1003475475 6:6478203-6478225 GGTGGGGGCTTCCAGGCTATAGG - Intergenic
1004604937 6:17185094-17185116 GTGGGGCACCTCCAGGCTATAGG + Intergenic
1005317164 6:24614322-24614344 GCTGGATATTTCCAGGGTATGGG - Intronic
1005370145 6:25123794-25123816 GGTGGGTGTTTCCAAGCAATTGG - Intergenic
1009908154 6:69893938-69893960 GGGTGGTGCTTCCAGACTATAGG - Intronic
1010383269 6:75248483-75248505 GCGGGGGACTTCCAGGCTATAGG - Intronic
1010452786 6:76021236-76021258 GGGGAGGGCTTCCAGGCTATAGG - Intronic
1011363422 6:86552756-86552778 GGGGAGAGCTTCCAGGCTATAGG - Intergenic
1013412697 6:109895917-109895939 GGGGGCGGCTTCCAGGCTATAGG + Intergenic
1014931127 6:127337473-127337495 CGGGGGTGCTTCCAGGGTATAGG - Intronic
1016871112 6:148817558-148817580 TGGGGGAGCTTCCAGGCTATAGG + Intronic
1018076097 6:160214980-160215002 GGCGGGGGCTTCCAGGCTATAGG - Intronic
1019245345 6:170705566-170705588 GAGGGGCGCTTCCAGGCTATAGG + Intergenic
1019252515 7:25549-25571 GGGGGGGGCTTCCAGGTTATAGG - Intergenic
1020610528 7:10391020-10391042 GTGGGGTACTTCCAAGCTATAGG - Intergenic
1020987589 7:15156016-15156038 TTGAGGTATTCCCAGGCTATTGG + Intergenic
1021102065 7:16595621-16595643 GCCGGGAACTTCCAGGCTATAGG + Intergenic
1021387643 7:20051426-20051448 GTGGGGGGCTTCCAGGCTATAGG - Intergenic
1022005781 7:26264369-26264391 TGGGGGGGCTTCCAGGCTATAGG + Intergenic
1022288241 7:28975800-28975822 AGGGGGCATATCCAGGCTTTTGG + Intergenic
1022679206 7:32528151-32528173 GGGTGGTGTTTCCAGGTCATAGG - Intronic
1023220990 7:37920184-37920206 TGGTGGTATTGCCAGGCGATGGG + Intronic
1024317958 7:48038872-48038894 GGGGGGTGGTTCCAGGTCATAGG + Intronic
1025108968 7:56196837-56196859 GAGGGAGACTTCCAGGCTATAGG - Intergenic
1026143137 7:67723254-67723276 AGTGGGGGTTTCCAGGCTATAGG - Intergenic
1026308849 7:69166301-69166323 GAGGGGGACTTCCAGGCTATAGG + Intergenic
1027186830 7:75977244-75977266 AGGGGGTACTTCCAGGTTACTGG + Intronic
1027979337 7:85197444-85197466 GGTGGGGGTTTCCAGGCTATAGG - Intergenic
1028281745 7:88938122-88938144 GGGGGAGGTTTCCAGGCTATAGG + Intronic
1030051097 7:105538344-105538366 GTGGGTTATTTCCAGGTTTTTGG + Intronic
1030396314 7:108990841-108990863 GGGGTGGGCTTCCAGGCTATAGG + Intergenic
1033122452 7:138678161-138678183 AGGGGGGACTTTCAGGCTATAGG - Intronic
1033942834 7:146677218-146677240 GTGGGGTTCTTCCAGGTTATAGG + Intronic
1035502782 8:102636-102658 GAGGGGCGCTTCCAGGCTATAGG - Intergenic
1036455562 8:8903732-8903754 GGGTGGGGCTTCCAGGCTATAGG - Intergenic
1037713976 8:21381234-21381256 GAGTGGTATTTCCGGGATATAGG - Intergenic
1039220026 8:35320214-35320236 GGGGGGCAGTTCCAGGTTATAGG + Intronic
1039308875 8:36294295-36294317 GGAGGGCATTCCCAGGCTAGAGG - Intergenic
1040402045 8:47061135-47061157 TGGGGGGGCTTCCAGGCTATAGG - Intergenic
1041359776 8:57040799-57040821 GGGGTGGGTTTCCAGGCTATAGG + Intergenic
1043535309 8:81196813-81196835 GTGGGGAGATTCCAGGCTATAGG - Intergenic
1043596711 8:81896231-81896253 GGGGGAGGCTTCCAGGCTATAGG - Intergenic
1045556776 8:103222035-103222057 GTGGGGGGCTTCCAGGCTATAGG + Intronic
1045579546 8:103463431-103463453 TGTGGGGGTTTCCAGGCTATAGG + Intergenic
1048655971 8:136536261-136536283 GTGGGGGACTTCCAGGCAATAGG - Intergenic
1048671829 8:136731035-136731057 GGGGAGAGCTTCCAGGCTATAGG - Intergenic
1049007688 8:139866018-139866040 TGGGGGGCCTTCCAGGCTATAGG + Intronic
1049517548 8:143069350-143069372 GGAGTGTATTTCAAGGCTAAGGG - Intergenic
1049964365 9:765191-765213 GGCGCGGGTTTCCAGGCTATAGG - Intergenic
1050060732 9:1707050-1707072 AGTGGGGACTTCCAGGCTATAGG - Intergenic
1050952534 9:11616142-11616164 CCGGGGGACTTCCAGGCTATAGG + Intergenic
1052311051 9:27069474-27069496 GGGGGGTATTACCTAGCAATGGG + Intergenic
1053241030 9:36495816-36495838 GGGGGGGCCTTCCAGGCTATAGG - Intergenic
1053641040 9:40080291-40080313 GGGGGTTGGTTCCAGGCTATAGG + Intergenic
1053765097 9:41385177-41385199 GGGGGTTGGTTCCAGGCTATAGG - Intergenic
1053799625 9:41756160-41756182 AGGGGGGACTTCCAGGCTATAGG - Intergenic
1054145593 9:61558838-61558860 AGGGGGGACTTCCAGGCTATAGG + Intergenic
1054188034 9:61968215-61968237 AGGGGGGACTTCCAGGCTATAGG - Intergenic
1054321782 9:63676587-63676609 GGGGGTTGGTTCCAGGCTATAGG + Intergenic
1054465333 9:65489946-65489968 AGGGGGGACTTCCAGGCTATAGG + Intergenic
1054543712 9:66296339-66296361 GGGGGTTGGTTCCAGGCTATAGG - Intergenic
1054650482 9:67620361-67620383 AGGGGGGACTTCCAGGCTATAGG + Intergenic
1057348795 9:94277120-94277142 GGGGGCGGATTCCAGGCTATAGG + Intronic
1058727676 9:107818691-107818713 GGGGTCTCTTTCCAGGCTGTGGG + Intergenic
1060056023 9:120413775-120413797 GGGGGGTATATGCAGGAAATGGG + Intronic
1060544663 9:124452936-124452958 GTGGGGTCCTTCCAGGCTTTGGG - Intronic
1062258496 9:135643862-135643884 AGCAGGGATTTCCAGGCTATAGG + Intergenic
1062364441 9:136202235-136202257 GGGGGTTACATCCAGGCTGTGGG - Intronic
1062740460 9:138171486-138171508 TGTGGCTATTTCCAGACTATAGG - Intergenic
1062747852 9:138226822-138226844 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
1202788812 9_KI270719v1_random:63366-63388 GGGGGTTGGTTCCAGGCTATAGG + Intergenic
1203605541 Un_KI270748v1:54774-54796 GAGGGGCGCTTCCAGGCTATAGG + Intergenic
1185533666 X:840694-840716 GGGGGGGATGTCCAGGCTGGGGG - Intergenic
1185975127 X:4711514-4711536 GGGGGGTGCTTCCAGGTTATAGG + Intergenic
1186440367 X:9580717-9580739 GGGGGGTGCTTTCAGGTTATAGG + Intronic
1188286017 X:28326293-28326315 GGGCGGGGCTTCCAGGCTATAGG + Intergenic
1188439634 X:30202686-30202708 TGGGGATGCTTCCAGGCTATAGG - Intergenic
1188803863 X:34563119-34563141 GGGTGGTGCTTCTAGGCTATAGG + Intergenic
1188841443 X:35022733-35022755 TGGGGGGTTTTCCAGGCTATAGG + Intergenic
1188898120 X:35695138-35695160 GGAGTGTGCTTCCAGGCTATAGG - Intergenic
1188993445 X:36852614-36852636 CGGGGGTATATCCAGACAATGGG - Intergenic
1191624477 X:63255507-63255529 TGGGGGGGTTTCCAGGATATAGG + Intergenic
1193537891 X:82736595-82736617 GCGGGGGGCTTCCAGGCTATAGG + Intergenic
1193709666 X:84863538-84863560 GAGGGGTGCTTCCAGGCTATAGG + Intergenic
1193809628 X:86036311-86036333 GGGAAGTGCTTCCAGGCTATAGG + Intronic
1194234295 X:91362749-91362771 GGAGGGTGCTTCCAGGTTATAGG + Intergenic
1195547026 X:106124116-106124138 AGTGGGGACTTCCAGGCTATAGG + Intergenic
1196523795 X:116707448-116707470 GTGGAGTATTGCCAGGCTATTGG + Intergenic
1196590032 X:117476339-117476361 GGGGAAAATTTCCAGGATATTGG - Intergenic
1197756920 X:130002096-130002118 GGCGGAAATTTCCAGGCTAGGGG + Intronic
1199368718 X:147020115-147020137 GGGGGGATCTTCCAGGCCATAGG + Intergenic
1199576935 X:149321426-149321448 GGGGCATGCTTCCAGGCTATAGG - Intergenic
1200742793 Y:6872039-6872061 TGGTGATATTTCCAGGCTAATGG + Intronic
1201694484 Y:16809907-16809929 AGGGGATGCTTCCAGGCTATAGG - Intergenic
1201701427 Y:16886559-16886581 GGGGGGTGCTTCCTGGTTATAGG - Intergenic
1202387723 Y:24341215-24341237 AAGGGGTGCTTCCAGGCTATAGG + Intergenic
1202483063 Y:25328913-25328935 AAGGGGTGCTTCCAGGCTATAGG - Intergenic