ID: 1127509085

View in Genome Browser
Species Human (GRCh38)
Location 15:59622548-59622570
Sequence CCTCCTCTGAAGGAGGTAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127509074_1127509085 11 Left 1127509074 15:59622514-59622536 CCTCCCCCTGCTGGCTGATGTGA 0: 1
1: 0
2: 2
3: 24
4: 290
Right 1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 38
4: 294
1127509079_1127509085 5 Left 1127509079 15:59622520-59622542 CCTGCTGGCTGATGTGATGGTCC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 38
4: 294
1127509075_1127509085 8 Left 1127509075 15:59622517-59622539 CCCCCTGCTGGCTGATGTGATGG 0: 1
1: 0
2: 2
3: 32
4: 341
Right 1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 38
4: 294
1127509077_1127509085 7 Left 1127509077 15:59622518-59622540 CCCCTGCTGGCTGATGTGATGGT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 38
4: 294
1127509078_1127509085 6 Left 1127509078 15:59622519-59622541 CCCTGCTGGCTGATGTGATGGTC 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 38
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127509085 Original CRISPR CCTCCTCTGAAGGAGGTAGA AGG Exonic
903766158 1:25735966-25735988 ACTCCTCCCAAGGAGGGAGAGGG + Intronic
904768333 1:32867495-32867517 CCTCTTCTGAGGGAGGGCGAAGG + Intronic
906846565 1:49198863-49198885 TCTCCTCAGAAATAGGTAGACGG - Intronic
907978249 1:59454694-59454716 AATACTCTGAAGGAAGTAGAGGG - Intronic
908001480 1:59684503-59684525 CCTCCTCTGAAAGCGGAAGAAGG + Intronic
908056286 1:60290699-60290721 CCCCCTCCGAAGTAGGAAGAAGG + Intergenic
910708462 1:90154717-90154739 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
913236250 1:116785670-116785692 CCTACTCTGGTGGAGGTAGCAGG - Intergenic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
913493565 1:119405471-119405493 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
917913589 1:179677738-179677760 CCTGCTCTGGTGGAGGTAGCAGG + Intronic
918847843 1:189641792-189641814 CATCCCATGAAGAAGGTAGAAGG + Intergenic
920071628 1:203306569-203306591 ACTCTTCTGAAGGAAGCAGAGGG + Intronic
920799999 1:209177358-209177380 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
920931713 1:210394847-210394869 CATGCACTGATGGAGGTAGAAGG - Intronic
921656882 1:217750064-217750086 CCTCTTCTGTGAGAGGTAGAGGG - Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1064371054 10:14751864-14751886 CCGCCTCCAAAGGAGGTAAAGGG + Intronic
1066207262 10:33201856-33201878 TCTCCTCTGAAGGAGTGAGAGGG - Intronic
1067079051 10:43203415-43203437 CGTCCTCTGAAGGCAGGAGACGG + Exonic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1068173113 10:53421936-53421958 CCTGCTCTGGTGGAGGTAAAAGG + Intergenic
1069648174 10:70019943-70019965 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1069816059 10:71195207-71195229 GCTCCTCTGAAGGAGGGAGGTGG + Intergenic
1070441181 10:76445086-76445108 CTTCCTCTCAAGGATCTAGAGGG + Intronic
1074197694 10:111203742-111203764 CCTGCTCTGAATGAGGAAGAGGG + Intergenic
1074476130 10:113776117-113776139 ACTCCTCTAAGGGAGGAAGAAGG + Intronic
1074526777 10:114269619-114269641 CTTCCCCTGAAGGTGGTAGATGG + Intronic
1074686261 10:115964917-115964939 CCTCCTCTGAAGGGGAGAGCTGG + Intergenic
1074713559 10:116198052-116198074 CCTCCTCTGCAAGAGCTAAAAGG + Intronic
1074875105 10:117607577-117607599 GCTCCTGTGAAGCAGGGAGATGG - Intergenic
1075288622 10:121209082-121209104 CCACCCCTGAAGCAGGTGGAAGG + Intergenic
1075794925 10:125113120-125113142 ACACCTCTTAAGGAAGTAGATGG + Intronic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1077011452 11:381001-381023 CCTCCTCTGAATGGGGAAGGGGG + Intronic
1078326241 11:10383547-10383569 CCGGCTCTGAAGGAGGGAGCCGG - Intronic
1079271058 11:18986552-18986574 CCTGCTCTGGTGGAGGTAGTAGG + Intergenic
1080885635 11:36365151-36365173 CCTTCTGTGAAGGAGGTAGCTGG + Intronic
1082934970 11:58646832-58646854 CCTGCTCTGGTGGAGGTAGCTGG + Intronic
1085240582 11:75050758-75050780 CCTGCTCTGGTGGAGGTAGCGGG + Intergenic
1085539512 11:77253821-77253843 CCAAGTCTGAAAGAGGTAGATGG + Intronic
1086223865 11:84483753-84483775 AATCATCTGAAAGAGGTAGAAGG + Intronic
1086462175 11:87016946-87016968 CCTCCTCTCTTGGAGGTGGAAGG - Intergenic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1086663229 11:89447866-89447888 CCACCTCTGCAGGTGTTAGATGG - Intronic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1087395360 11:97589825-97589847 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1088712611 11:112522079-112522101 CCTCCTGAGAGGGAGGAAGAGGG + Intergenic
1089652730 11:119925091-119925113 CCCCCTTTGAAGGAGGTTGGTGG + Intergenic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1098326798 12:69311935-69311957 CCACAGCTGAAAGAGGTAGACGG - Intergenic
1099042041 12:77667903-77667925 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1100669467 12:96795125-96795147 CCTGCTCTGGTGGAGGTAGTAGG + Intronic
1102872738 12:116426685-116426707 CCAACTCTGCAGGCGGTAGATGG + Intergenic
1108134272 13:47338536-47338558 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1108189009 13:47917807-47917829 CCTGCTCTGATGGAGGTAGTGGG - Intergenic
1109123504 13:58488413-58488435 CCTCCACAGAAGAATGTAGATGG - Intergenic
1109201272 13:59434568-59434590 CCTACTCTGGTGGAGGTAGCAGG + Intergenic
1111225662 13:85267228-85267250 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1114552109 14:23538704-23538726 CTTCCTCTGAAGGAGGCAAGAGG + Intronic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116861593 14:50000167-50000189 CGTCCTCTGACGGTGGAAGAGGG - Intronic
1118293808 14:64550143-64550165 CCGCCTCTGGAGGAGGGCGAGGG - Intronic
1118765068 14:68904152-68904174 CCTCCTCAGAAGATGCTAGAAGG + Intronic
1119932807 14:78564563-78564585 CCTCCTCTCTAGGAGGTATATGG + Intronic
1121667000 14:95680174-95680196 GCACCTCTGAAGGAGGAAGCTGG - Intergenic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1127014530 15:54668824-54668846 CCTGCTCTGGTGGAGGTAGAAGG - Intergenic
1127122683 15:55785258-55785280 CCTCTTCTGGTGGAGGGAGACGG - Intergenic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG + Intergenic
1129631732 15:77267467-77267489 CCTGCTCTGGTGGAGGTAGCAGG - Intronic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131051946 15:89354213-89354235 AGTCCTCTGAAGGAGGTTGCAGG + Intergenic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131220759 15:90582130-90582152 CTTCCTCTGGAGGAGATAAATGG + Intronic
1132897540 16:2236213-2236235 CCCCCTAGGAGGGAGGTAGACGG - Exonic
1135883181 16:26279310-26279332 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1137894692 16:52198504-52198526 CCGCCTCTAAAGGAGGAAAAAGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142142790 16:88479916-88479938 CCCCCGCCGAAGGAGGAAGATGG + Intronic
1203123225 16_KI270728v1_random:1556214-1556236 GCTACACTGAAGGTGGTAGAGGG + Intergenic
1142546987 17:711436-711458 CCTCCTCTTGATGTGGTAGAAGG - Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143368258 17:6422411-6422433 CCTCCTCTGCACTAGGAAGATGG + Intronic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1143937540 17:10502616-10502638 CCTCCTATGAATGAGGAATATGG - Intronic
1145012750 17:19378907-19378929 GAGCCTCTGAAGGAGGAAGACGG + Exonic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1148533436 17:48417267-48417289 TTTCCTCTACAGGAGGTAGAAGG - Intronic
1148821761 17:50364037-50364059 CCTGCTCTGAAGGTTGTAGTGGG + Intergenic
1149142324 17:53447276-53447298 ACCTCACTGAAGGAGGTAGAGGG - Intergenic
1150787602 17:68175572-68175594 CCTCCTGTGAAGGAAGGAAAGGG - Intergenic
1151078861 17:71305055-71305077 CCTCCTCTGGTGGAGGTAGGAGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1153606190 18:6835974-6835996 CCTGCTCTGATGGAGCTACAGGG + Intronic
1153668657 18:7389689-7389711 CTTCCTCTGAAGATGGTAGTTGG - Intergenic
1154090071 18:11349779-11349801 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1155573766 18:27223547-27223569 CCTGCTCTGATGGAGGTAGCAGG + Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1156893314 18:42215211-42215233 CCTCCTCTGGTGGAGGTGGCAGG + Intergenic
1158695605 18:59700513-59700535 ACTCCTATGAAAGAGGTGGATGG - Intergenic
1159838499 18:73369729-73369751 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1160137702 18:76286633-76286655 AATCCTTTGAAGTAGGTAGAGGG + Intergenic
1160243024 18:77136531-77136553 CCAGCTCTGAGGGAGGGAGACGG + Intergenic
1160418310 18:78727073-78727095 CTTCCTCTGAGGGAGGTGGCAGG - Intergenic
1161578418 19:5067463-5067485 CGTGCTCTGAAGATGGTAGAAGG + Intronic
1162925345 19:13928112-13928134 TCTCCTCTGAAGCAGGTTGCTGG + Exonic
1164497671 19:28783322-28783344 CCTCCCCTGAAGGGGGTGGTGGG + Intergenic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1165457203 19:35919676-35919698 ACACCTCTGAAGGAGGCAGAGGG + Intergenic
1165724642 19:38104247-38104269 CCTCCGCTGAAGGAGGCTGTAGG + Intronic
1166894366 19:46014940-46014962 CCTCCCCGGAAGGGGGTACACGG - Intronic
1167713240 19:51124995-51125017 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
1167715831 19:51142393-51142415 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
1168552258 19:57306280-57306302 CATCCTCTGAAGGTGGAGGATGG - Intergenic
925207952 2:2023249-2023271 ACTCCTCTGAGGGAGGCAGCTGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925652269 2:6104007-6104029 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
925705592 2:6681818-6681840 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
926109588 2:10173496-10173518 CCTCTGCTGAGGGAGGTAGGGGG - Intronic
926737410 2:16083833-16083855 CCTCTTCAGCAGGAGGTCGAGGG + Intergenic
926774092 2:16405049-16405071 ACTCCTCTCCTGGAGGTAGAAGG + Intergenic
927081988 2:19639625-19639647 CCTCCCCTGAAGATGATAGAAGG - Intergenic
927747611 2:25635526-25635548 CCTCCTGTGAACGTGGTATATGG - Intronic
928038489 2:27849788-27849810 CCTGTTCTGAAAGAGCTAGAGGG - Intronic
929023456 2:37576660-37576682 CCTCCACTTCAGGAGATAGAGGG - Intergenic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
930423008 2:51177256-51177278 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
930469641 2:51795779-51795801 CCTGCTCTGCTGGAGGTAGCAGG - Intergenic
930697137 2:54423352-54423374 CCTCCTCAGAAGGGGGCGGAGGG - Intergenic
931641322 2:64383200-64383222 CCTGCCCTGAATGAGGGAGACGG + Intergenic
932414365 2:71564800-71564822 CCTCCTGGAAAGGAGGAAGAGGG - Intronic
932452693 2:71824626-71824648 ACTCCTCTGGAGGAGGTAGTTGG + Intergenic
934119040 2:88822698-88822720 CCTACTGTTTAGGAGGTAGAGGG - Intergenic
936162492 2:110095050-110095072 CCTCCTGTTTAGGAGGTAGAGGG - Intronic
936182168 2:110276316-110276338 CCTCCTGTTTAGGAGGTAGAGGG + Intergenic
936270291 2:111043760-111043782 GCTCCTCTGGAGGAGTTTGATGG - Intronic
936611410 2:114005462-114005484 CCTCCTCTGGCAGAGGGAGAGGG - Intergenic
937118159 2:119424333-119424355 CCTCCTCTGAAGCAAGTGGTGGG - Intergenic
937410494 2:121670581-121670603 CCTCCTCTGGGGGAGGTGGCAGG - Intergenic
938216535 2:129522556-129522578 CCTGCTCTGATGGAGGTAGCAGG + Intergenic
938564189 2:132503456-132503478 CCTGCTTTGATGGAGGTAGCAGG + Intronic
940045871 2:149409290-149409312 CCTGCTCTGGTGGAGGTAGCAGG + Intronic
943449308 2:188028386-188028408 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
945739194 2:213640632-213640654 CCTGCTCTCATGGAGGTAGCAGG + Intronic
1168892091 20:1301183-1301205 CCTCCACAGCAGGAAGTAGATGG - Intronic
1169776584 20:9261920-9261942 CCTTGTCTCAAGGAGGCAGAAGG + Intronic
1170650808 20:18239329-18239351 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1171018987 20:21568027-21568049 TGACATCTGAAGGAGGTAGAGGG - Intergenic
1172028833 20:31967914-31967936 CCTCCGAGGAAGGAGGGAGAGGG + Intergenic
1172187742 20:33041830-33041852 CCTGGTCTGAAGGCTGTAGAGGG + Intronic
1174106161 20:48163885-48163907 CCTCCCGTGAAGGAGGCAGCTGG + Intergenic
1175507513 20:59496246-59496268 CCTTATCCGAAGGAGGCAGAGGG - Intergenic
1178732923 21:35121062-35121084 CCTGCTCTGGTGGAGGTAGCAGG - Intronic
1179007984 21:37531415-37531437 CCTCTTCTGAAGCAGGTTAAGGG - Intergenic
1179712203 21:43269701-43269723 CTTCCACTCAAGGAGGCAGATGG - Intergenic
1181101683 22:20544926-20544948 CCTCCTAAGAGGGAGGCAGAAGG - Intronic
1184806099 22:46795929-46795951 GAGCCTCTGAAGGAGGGAGAGGG + Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
949189657 3:1236341-1236363 CCTGCTCTGGTGGAGGTAGTAGG - Intronic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
949799219 3:7884660-7884682 CCTACTCTGGTGGAGGTAGCAGG - Intergenic
950111827 3:10423615-10423637 CCTCCCCAGAAGGAGGAATAAGG - Intronic
951341618 3:21494916-21494938 TTTCCTATAAAGGAGGTAGACGG - Intronic
951637872 3:24799284-24799306 CCACCTCTGGAGGTTGTAGAGGG - Intergenic
951727230 3:25774000-25774022 CCTACTCTGATGGAGGTGGCAGG + Intronic
952764936 3:36945407-36945429 CCTCATCTGTAGGAGCTAGGGGG - Intergenic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
953276773 3:41508577-41508599 CCTCCTCTGGTGGAGGTAGCAGG - Intronic
957034451 3:75281090-75281112 CCTCTGCTGAAGGAGGTGGGGGG - Intergenic
958819061 3:98951926-98951948 CCTGCTCTGATGGAGGTAGCAGG + Intergenic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959877873 3:111407284-111407306 CCTGCTCTGGTGGAGGTAGCAGG - Intronic
960824690 3:121770547-121770569 CCAAGTCTGAAGGAGGCAGAAGG - Exonic
961967901 3:130925460-130925482 CCTGCTCTGGTGGAGGTAGCTGG + Intronic
962034498 3:131636794-131636816 CCTGCTCTGGTGGAGGTAGCAGG - Intronic
962147364 3:132854933-132854955 CCTGCTCTGGTGGAGGTAGTGGG + Intergenic
963869666 3:150401661-150401683 CCTCTTCTGGAAGAGGTAGGTGG - Intergenic
964075716 3:152689031-152689053 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
964867418 3:161276568-161276590 CCTGCTCTGGTGGAGGTAGCCGG - Intergenic
965132771 3:164723208-164723230 CCTGCTCTGACGGATGTAGCAGG + Intergenic
965184614 3:165446866-165446888 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
966352657 3:179047111-179047133 CCTGCTCTGGTGGAGGTAGCCGG - Intronic
966608371 3:181844304-181844326 CCTCCCCTCCAGCAGGTAGAGGG - Intergenic
967380185 3:188849058-188849080 CTCCCACTGAAGGAGGTAGAAGG + Intronic
967742013 3:193014144-193014166 ACTGCTTTGAAGGAGGTAGTGGG - Intergenic
971255207 4:25008118-25008140 ACTTCCCTGAAGGAGGTAGAAGG - Intronic
972299966 4:37775915-37775937 CCTCCTCTGAAGAACGCAGCTGG - Intergenic
972520890 4:39855172-39855194 CCTGGTCTGATGGAGGAAGAGGG + Intronic
974017327 4:56659431-56659453 GTTACTCTGAAGGTGGTAGAAGG + Intronic
975199610 4:71570977-71570999 CCTCCTCTCTTGGAGGTGGAAGG - Exonic
975614091 4:76229721-76229743 CCTGCTCTGATGGAGGTATCAGG + Intronic
976361581 4:84185049-84185071 TCTTCTCTGATGGAGGCAGAAGG + Intergenic
976887904 4:90008150-90008172 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
976918204 4:90404619-90404641 CCTGCTCTGGTGGAGGTAGCAGG - Intronic
977513730 4:97994684-97994706 CCTACTCTGGTGGAGGTAGCAGG + Intronic
979740957 4:124150275-124150297 GCACCTCTGAAGGTGGTAAATGG - Intergenic
980409902 4:132403665-132403687 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
980861007 4:138499729-138499751 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
981906572 4:149927994-149928016 CCTCTTCTAAAGGAGGTAACTGG + Intergenic
983220646 4:165040766-165040788 CATCTACTGAGGGAGGTAGAGGG + Exonic
984020085 4:174474982-174475004 CCAGCTCTGATGGAGGTAGGAGG - Intergenic
984608699 4:181813784-181813806 TCTCATCTTACGGAGGTAGAAGG + Intergenic
985326388 4:188775824-188775846 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
985339556 4:188934715-188934737 CCTGCCCTGAAGGAGAAAGAAGG + Intergenic
985868872 5:2538258-2538280 CCCCCTCTGAAGGAGCAAAAGGG + Intergenic
986829442 5:11559734-11559756 CCCCCACTGAAGGAGAAAGATGG - Intronic
989431492 5:41360743-41360765 CCTGCTCTGGTGGAGGTAGCAGG + Intronic
990649839 5:57885885-57885907 CCTCTTTTTAAGGAGGGAGAAGG - Intergenic
990788040 5:59444865-59444887 CCCCATCTGAAGGAGATAGCTGG - Intronic
991175799 5:63686533-63686555 CCTCTTCAGCAGGAAGTAGATGG - Intergenic
991623043 5:68565954-68565976 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
992234144 5:74691694-74691716 TTTCCTCTGAGGAAGGTAGAGGG + Intronic
992898702 5:81270719-81270741 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
993168571 5:84386021-84386043 CATCCTTTAAAGGAGGCAGATGG - Intergenic
996616003 5:125441686-125441708 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
996631908 5:125643031-125643053 CCTGCTCTGGAGGAGGTGGCAGG - Intergenic
997343061 5:133161689-133161711 CCTCATGAGAAGGAGGCAGAGGG + Intergenic
997718467 5:136059481-136059503 CCTTCTCTTAAGGAGGTTGTAGG + Intronic
998475020 5:142413171-142413193 CATCCTCTGAAGCAGGTAGTAGG + Intergenic
999020987 5:148165007-148165029 CACCCTCTAAAGGAGTTAGAGGG + Intergenic
999086154 5:148892161-148892183 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
999687873 5:154118557-154118579 CCTGGTCTGAAGGAGGCAGCAGG - Intronic
999687985 5:154119237-154119259 CCTGGTCTGAAGGAGGCAGCAGG + Intronic
999930910 5:156432152-156432174 TCTGCTCTGATGGAGGTAGCAGG + Intronic
1002011872 5:176289957-176289979 CCTCCACTGATGGATGTAGCGGG - Intronic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002215895 5:177632415-177632437 CCTCCACTGATGGATGTAGCGGG + Intergenic
1004917586 6:20346288-20346310 CCTGCTCTGATAGAGGGAGAAGG - Intergenic
1005244169 6:23862449-23862471 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1005512253 6:26521547-26521569 CTGCCTGTGAAGGAGGGAGAGGG - Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1006205441 6:32337458-32337480 CCTCATCTGAAGGAGACAGTGGG + Intronic
1006402230 6:33824635-33824657 CCTCCTATGAAACAGGAAGAGGG + Intergenic
1007495338 6:42256406-42256428 TCTCCAGTGATGGAGGTAGAAGG - Intronic
1008231268 6:48987072-48987094 CCTACTCTGGTAGAGGTAGAAGG - Intergenic
1008633916 6:53390488-53390510 ATTTCTCTGAAGGAGTTAGAAGG + Intergenic
1008981437 6:57488570-57488592 CCTCCCCTGAAGGTGGTAACAGG - Intronic
1009169531 6:60381600-60381622 CCTCCCCTGAAGGTGGTAACAGG - Intergenic
1009810516 6:68657520-68657542 CCTCCTCTGCAGGTGATAGGTGG + Intronic
1010027866 6:71240308-71240330 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1011375468 6:86681853-86681875 CCTGCTCTGATGGAGGTAGCAGG + Intergenic
1011923908 6:92617960-92617982 CCTGCTCTGGTGGAGGTAGTAGG + Intergenic
1012273509 6:97243951-97243973 CCTGCTCTGGTGGAGGTAGCAGG + Intronic
1013221267 6:108080035-108080057 CCTGCTCTGGAGGAGGTGGCAGG + Intronic
1015873298 6:137798642-137798664 TTTCCTCTGAAGGGGGGAGATGG + Intergenic
1016017518 6:139201062-139201084 TCTCCTGTGAATGAGGAAGAGGG - Intergenic
1016351700 6:143176190-143176212 CCTGCTCTGGTGGAGGTAGCAGG + Intronic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1021629337 7:22629115-22629137 CCTTCTAAGAAGGAGGTAAAAGG + Intronic
1021774974 7:24044663-24044685 CCTCATAAGAAAGAGGTAGAGGG + Intergenic
1022499557 7:30873949-30873971 CCTCCTCTGATGGCCGCAGAGGG - Intronic
1022690488 7:32647160-32647182 CCTCTTTTGAAGGATGGAGAAGG + Intergenic
1023657559 7:42440603-42440625 CCTGCTCTGCTGGAGGTAGCAGG + Intergenic
1024866769 7:53912133-53912155 CCTTCTAAGAAGGAGGTAAAGGG - Intergenic
1026265446 7:68792231-68792253 CCACCTTTGAAGGTGGAAGATGG - Intergenic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1029150554 7:98477399-98477421 CCTTCTCAAAGGGAGGTAGAAGG + Intergenic
1030435460 7:109513843-109513865 TCTGCCCTGAAGGAGGTAGAAGG - Intergenic
1030455851 7:109772913-109772935 CCTGCTCCGATGGAGGTAGAAGG - Intergenic
1033216178 7:139495275-139495297 CCTCCTCTGAAGAGGGCAGTTGG - Intergenic
1037000124 8:13707425-13707447 CATCATCTCAGGGAGGTAGAAGG - Intergenic
1037350654 8:17951437-17951459 CATGTTCAGAAGGAGGTAGATGG + Intronic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1038908806 8:31938164-31938186 CCTACTCTGGTGGAGGTAGCAGG - Intronic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1040885812 8:52262447-52262469 CGTCCTGTGAAGTCGGTAGAAGG - Intronic
1041558422 8:59185893-59185915 CCTCCTCTGAATAAGAAAGAGGG + Intergenic
1042088658 8:65134219-65134241 CCTCCACTGAAACAGGTAGCCGG + Intergenic
1043616428 8:82130722-82130744 CCTTCTCTGATGGAGGTGGCAGG - Intergenic
1046327698 8:112671505-112671527 ACTCCTTTGAAAGAGGGAGAAGG - Intronic
1046394660 8:113625871-113625893 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1048243607 8:132768779-132768801 CCCCTTCTGCAGGAGGGAGAGGG - Intergenic
1048615326 8:136067764-136067786 CCTCATCAGAAGGAGGAAAAGGG + Intergenic
1048685897 8:136905106-136905128 CCTCCTCTGTAGGACATAAAGGG + Intergenic
1049265060 8:141663424-141663446 CCCCCTCTGAAGGCGGGAGGGGG + Intergenic
1051261451 9:15269275-15269297 CCTGCTCTGATGGAGACAGAGGG - Intronic
1052995982 9:34551861-34551883 CCTCCCCTGAGGGAGGAAGGAGG + Exonic
1053023841 9:34714714-34714736 CCTCCTCCAGGGGAGGTAGAGGG - Intergenic
1053321000 9:37098743-37098765 GCCCCTCTGAAAGAGGTGGAGGG - Intergenic
1054869695 9:70038015-70038037 CCTCCTCTGGAGGAGTGAGGAGG + Intergenic
1054898397 9:70339825-70339847 CATCCCCTGAAAAAGGTAGATGG + Intronic
1054909675 9:70442781-70442803 CCTCCTTTCAAAGAGGTGGAGGG - Intergenic
1055156369 9:73067348-73067370 CCTGCTCTGATGGAGGTAGCAGG - Intronic
1055924179 9:81492848-81492870 ACTCCTCTCATGGAGGTAGTGGG + Intergenic
1056249999 9:84737991-84738013 CCTCAGCTGAAAGAGGTTGAAGG - Intronic
1057475773 9:95399755-95399777 CCTGCTCTGGTGGAGGTAGCAGG - Intergenic
1057717141 9:97503669-97503691 CCTACCCTGAAGGAGGGAGAAGG - Intronic
1057912929 9:99034194-99034216 CTTCCCATGACGGAGGTAGAGGG - Intronic
1059032538 9:110714484-110714506 CCAACTCTGAAGGAGTCAGAAGG - Intronic
1059049086 9:110902831-110902853 ATGCCTCTGATGGAGGTAGAGGG - Intronic
1060860135 9:126947284-126947306 CCTCCTGTGAAGTAGGTACAGGG + Intronic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061389600 9:130310111-130310133 CCTACTCAGAAGCAGGCAGAGGG - Intronic
1061801584 9:133115983-133116005 CCACCTCTGTAGGACGGAGAAGG - Intronic
1062391447 9:136335571-136335593 CGTCCTCTGAATGAGTTAGCAGG + Intronic
1062412759 9:136433269-136433291 CCTCCTCTGCAGGCGGGAGTGGG - Exonic
1186536911 X:10359410-10359432 CCTCCTCTCATTGAGGTAGGAGG - Intergenic
1187109230 X:16279013-16279035 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1187752147 X:22478575-22478597 CCTGCTCTGGGGGAGGTAGCAGG + Intergenic
1189035948 X:37493483-37493505 TCTGCTCTGAAGAATGTAGAGGG + Intronic
1189946027 X:46179998-46180020 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1190937452 X:55009338-55009360 GCTTCTCTGAAGGTGGTAGGGGG + Exonic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1192333596 X:70199744-70199766 CCTCCTCTGGGAGAGGTAGAGGG + Intronic
1192673953 X:73175372-73175394 CCTGCTCTGGTGGAGGTAGTAGG + Intergenic
1193016740 X:76741875-76741897 CCTGCTCTGATGGAGATAGCAGG - Intergenic
1193203143 X:78715649-78715671 CCTCCTTTGGTGGAGGTAGCAGG - Intergenic
1194214378 X:91110499-91110521 CCTGCTCTGATGGAGGTGGCAGG + Intergenic
1194353810 X:92856006-92856028 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1194470194 X:94284966-94284988 CCTGCTCTGGTGGAGGTAGGAGG + Intergenic
1194881766 X:99261100-99261122 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1195223145 X:102765754-102765776 CCTCCCCTGAAGTAAGGAGAGGG + Intergenic
1196977856 X:121179895-121179917 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1197493852 X:127153411-127153433 CCTGCTCTGATGGACGTAGACGG + Intergenic
1197545244 X:127816098-127816120 CCTACTCTGGTGGAGGTAGCAGG - Intergenic
1198943233 X:141981924-141981946 CCTGCTCTGGTGGAGGTAGCAGG + Intergenic
1199684427 X:150254006-150254028 CCTCCTTTCTAGGAGGCAGATGG - Intergenic
1199983336 X:152933186-152933208 CCTACTCTGGAGGAGCTTGAGGG - Intronic
1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG + Intergenic
1200090634 X:153634295-153634317 CCTTCACTGAAGGAGGAAGCCGG - Intergenic
1200662170 Y:5973078-5973100 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1200899468 Y:8413963-8413985 CATCTACTGAGGGAGGTAGAGGG - Intergenic
1201722200 Y:17111987-17112009 CCTCTACTGAATGAGGGAGATGG + Intergenic