ID: 1127509757

View in Genome Browser
Species Human (GRCh38)
Location 15:59628955-59628977
Sequence TGAGTCTCACTCTAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31913
Summary {0: 1, 1: 2, 2: 74, 3: 2019, 4: 29817}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127509755_1127509757 20 Left 1127509755 15:59628912-59628934 CCTCCATTGAAGTTTTTTTTTTT 0: 1
1: 3
2: 49
3: 512
4: 3954
Right 1127509757 15:59628955-59628977 TGAGTCTCACTCTAACAGCCAGG 0: 1
1: 2
2: 74
3: 2019
4: 29817
1127509756_1127509757 17 Left 1127509756 15:59628915-59628937 CCATTGAAGTTTTTTTTTTTTTG 0: 1
1: 9
2: 236
3: 2210
4: 16588
Right 1127509757 15:59628955-59628977 TGAGTCTCACTCTAACAGCCAGG 0: 1
1: 2
2: 74
3: 2019
4: 29817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127509757 Original CRISPR TGAGTCTCACTCTAACAGCC AGG Intronic
Too many off-targets to display for this crispr