ID: 1127515446

View in Genome Browser
Species Human (GRCh38)
Location 15:59689155-59689177
Sequence CTGGAGGGGCGAAGAGGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 296}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127515446_1127515463 27 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515463 15:59689205-59689227 TCGCAAAAAGCAGGGCCGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 79
1127515446_1127515459 4 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515459 15:59689182-59689204 GCGACGTGGGGCTGACGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 115
1127515446_1127515450 -10 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515450 15:59689168-59689190 GCCCCTCCAGGCCGGCGACGTGG 0: 1
1: 0
2: 0
3: 11
4: 155
1127515446_1127515460 18 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515460 15:59689196-59689218 ACGGCCAGGTCGCAAAAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 32
1127515446_1127515461 19 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515461 15:59689197-59689219 CGGCCAGGTCGCAAAAAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1127515446_1127515452 -9 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515452 15:59689169-59689191 CCCCTCCAGGCCGGCGACGTGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1127515446_1127515454 -8 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515454 15:59689170-59689192 CCCTCCAGGCCGGCGACGTGGGG 0: 1
1: 0
2: 1
3: 8
4: 115
1127515446_1127515457 -1 Left 1127515446 15:59689155-59689177 CCTCGTCCTCTTCGCCCCTCCAG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1127515457 15:59689177-59689199 GGCCGGCGACGTGGGGCTGACGG 0: 1
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127515446 Original CRISPR CTGGAGGGGCGAAGAGGACG AGG (reversed) Exonic
900325831 1:2108249-2108271 GGGCAGGGGCGAAGAGGCCGGGG - Intronic
900569193 1:3350020-3350042 TTTGAGGGGGGAAGAGGACAGGG + Intronic
900685373 1:3944764-3944786 CTGGAGGGACGCTGAGGACAAGG - Intergenic
901608095 1:10475111-10475133 CAGGAGGGGGCAAGAGGTCGGGG - Intronic
902449922 1:16490614-16490636 ATGGAGGCGCGAGGAGGAGGTGG - Intergenic
902472112 1:16656500-16656522 ATGGAGGCGCGAGGAGGAGGTGG - Intergenic
902482011 1:16717048-16717070 GAGGAGGGGCGAAGAGCAGGTGG - Intergenic
902486691 1:16750946-16750968 ATGGAGGCGCGAGGAGGAGGTGG + Intronic
902504538 1:16930576-16930598 GTGGAGGCGCGAGGAGGAGGTGG + Exonic
903228465 1:21907166-21907188 CTGGAGGGTCCAAGCGGACCAGG - Intronic
903281211 1:22251024-22251046 CGGGAGGGGAGGGGAGGACGAGG - Intergenic
903330055 1:22592693-22592715 CTGGAGGGGCAGGGAGGACAGGG + Intronic
903478185 1:23634796-23634818 CTGGAGGGGCAGAGTGGGCGAGG + Intronic
903674344 1:25054810-25054832 CTGGAGGGACGGAGAGGAGGGGG + Intergenic
904318910 1:29683890-29683912 CTGGAGGAGAGAACAGGACCAGG + Intergenic
905222687 1:36459738-36459760 CAGGAGGGTGGAAGAGGAGGAGG + Intronic
909627873 1:77738881-77738903 ATGGAGGGGAGGAGAGAACGGGG + Intronic
911474306 1:98357470-98357492 AAGGAGGGGGGAAGAGGAGGAGG - Intergenic
912430599 1:109626539-109626561 CTGGAGGGGCGGAGGGGCAGAGG + Intronic
914749960 1:150528058-150528080 CCGGATAGGCGAAGAGGAAGAGG - Intergenic
914854658 1:151342480-151342502 CTGGAGGGGCAGAGAGGCCAGGG - Exonic
915163185 1:153933694-153933716 CTGGAAGGGCTAAGTGGGCGGGG - Exonic
915367613 1:155324500-155324522 CTGTAGGGCGGGAGAGGACGGGG - Intronic
916143820 1:161722823-161722845 TTGGAGGGGTGAAGAAGAAGGGG + Intronic
918046210 1:180942465-180942487 CTGCAGGCGAGAAGAGGATGCGG + Intronic
922165037 1:223108317-223108339 CTGGAGGGGCAGGGAGGATGAGG - Intergenic
922609297 1:226912706-226912728 CTGGAGACGCGAAAGGGACGTGG - Intronic
923285045 1:232486117-232486139 CTGGATGGGAGGAGAGGAAGGGG - Intronic
924805753 1:247360297-247360319 CTTAAGTGGGGAAGAGGACGGGG + Intergenic
1063105200 10:2986588-2986610 GTGGAGGGGGGAGGAGGAGGAGG - Intergenic
1063246625 10:4227007-4227029 ATGGATGGGTGAAGAGGAGGTGG - Intergenic
1063535334 10:6877331-6877353 CTGAAAGAGAGAAGAGGACGTGG + Intergenic
1065255400 10:23861664-23861686 ATGGAGAGGCCAATAGGACGAGG + Intronic
1065625579 10:27625587-27625609 GTGGAGAGGCGGAGAGGACAGGG + Intergenic
1066046980 10:31603271-31603293 CGCGAGGGGCGAAGAAGAGGTGG + Intergenic
1066247154 10:33594507-33594529 CTGGAGGTGAAAAGAAGACGTGG - Intergenic
1069601447 10:69710801-69710823 CTGGAGGGGAGAAGGGCAGGGGG - Intergenic
1069789516 10:71010749-71010771 CTGGGAGGGCAAAGAGGACAAGG - Intergenic
1069844044 10:71358446-71358468 CTGAAGGGGCGGGGAGGACTGGG - Intronic
1070783617 10:79150901-79150923 CAGGAGGGAGGAAGAGGATGGGG - Intronic
1072562209 10:96586830-96586852 CCGGAGGGGCGCGGAGGATGAGG - Exonic
1072629360 10:97134813-97134835 CTAGAGGAGAGATGAGGACGCGG + Intronic
1074815434 10:117138345-117138367 CTGGACGTGCTCAGAGGACGCGG - Intergenic
1075546890 10:123361993-123362015 CAGGAGGGGAGCAGAGGAGGTGG - Intergenic
1075726059 10:124611509-124611531 CTGGAGGGGCTTAGGGGACAAGG + Intronic
1076053384 10:127352322-127352344 GGGGAGGGGCAAAGAGGATGGGG + Intronic
1076152231 10:128172000-128172022 GGGGAGGGGAGAAGAGGACAGGG - Intergenic
1076612617 10:131736221-131736243 CAGGAGGCAGGAAGAGGACGTGG + Intergenic
1076948508 10:133666781-133666803 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076951466 10:133676689-133676711 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076952456 10:133679999-133680021 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076955412 10:133742960-133742982 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076956402 10:133746270-133746292 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076957390 10:133749579-133749601 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076959363 10:133756188-133756210 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076989840 11:267310-267332 GGGGAGGAGCGAAGAGGAGGGGG + Intergenic
1076989944 11:267561-267583 GGGGAGGGGCGAGGAGGAGGCGG + Intergenic
1077010467 11:377043-377065 CGGGGAGGGCGAAGAGGAGGAGG + Exonic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078615682 11:12863433-12863455 ATGGAGGGCTGAAGAGGATGGGG + Intronic
1079110221 11:17601238-17601260 CTGGTGGGGCACAGAGGAGGAGG + Intronic
1081744474 11:45463255-45463277 ATGGAGGTGCCAAGAGGAAGGGG + Intergenic
1081857135 11:46311100-46311122 CTGGAGGGGGGCAGAGAGCGGGG - Exonic
1081980062 11:47260690-47260712 CTGGAGTGGGGAAGAGGCTGAGG + Intronic
1083305241 11:61758493-61758515 TTGGAGGGAAGAAGAGGAGGTGG + Intronic
1083475098 11:62910260-62910282 CTGGAAGGAAGAAGAGGAAGAGG - Exonic
1083997332 11:66278780-66278802 CTGCATGGGAGCAGAGGACGAGG - Intronic
1084637809 11:70404451-70404473 CTGGAGAGCCGAGGAGGAGGCGG - Intronic
1085803338 11:79611719-79611741 CTGGAGGGTGGAAGAGGCCTTGG + Intergenic
1087375286 11:97332198-97332220 CTGGAGTGGCCAGGAGGAGGAGG + Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1090853992 11:130596248-130596270 CTGGAAGGGCCAAGAGGAAAAGG - Intergenic
1091070461 11:132558284-132558306 GAGGAGGGGAGAAGAGGAAGAGG - Intronic
1091798609 12:3310929-3310951 CTGGAGGGGTGAGGAGGAGGGGG + Intergenic
1092537509 12:9403303-9403325 CTGGAGGGGGGAAGAGGGGCAGG - Intergenic
1092546365 12:9455263-9455285 CTGGAGGGGCGGAGAGAAACAGG + Intergenic
1092557317 12:9570472-9570494 CTGGAGGGGGGAAGAGGGGCAGG + Intergenic
1094506576 12:31066811-31066833 CTGGAGGGGCGGAGAGAAACAGG - Intergenic
1095505345 12:42891417-42891439 GTGAAGGGGTGAAGGGGACGTGG - Intergenic
1096411005 12:51377166-51377188 CTGGAGGGGCCCAGAGGAGGGGG - Intronic
1096496211 12:52040778-52040800 TAGGAGGGGCAAAGAGGAGGAGG - Intronic
1096867459 12:54573274-54573296 CAGGAGGGGCCAAGAGGAGGTGG + Intronic
1097250146 12:57627959-57627981 CTGCAGGGGTGAAGCGGAAGAGG - Intronic
1101070617 12:101071555-101071577 GTGGAGGGCTGAAGAGGAGGGGG + Intronic
1101128532 12:101664664-101664686 CTGGAGGGAGGAAGAGGAGAGGG + Intronic
1101376008 12:104172217-104172239 CTGGAGGGGAGCAGGGGGCGGGG + Intergenic
1103113746 12:118307211-118307233 ATGGGGGGGGGAAGAGGAGGCGG - Intronic
1106499619 13:30315395-30315417 CTTGAGGGGCAAAGAGGAGCTGG - Intergenic
1106510471 13:30408507-30408529 ATGGAGGCGCGAGGAGGAGGGGG + Intergenic
1107773342 13:43811605-43811627 CTGGAGGGGAGGAGGGGATGTGG + Intergenic
1112199254 13:97259385-97259407 GTGCAGGGGTGAAGAGGACTGGG - Intronic
1112365531 13:98752498-98752520 CGGGAGGCGCGAAGGGTACGCGG - Intronic
1113895038 13:113759070-113759092 CTGGAGGGGAGAAGGGGGAGCGG + Intergenic
1114532708 14:23405502-23405524 GTGGAGGGGGGAAGGGGACTTGG + Intronic
1121104343 14:91270968-91270990 GTGGAGGGGCGCAGAGGGAGGGG + Intergenic
1121104357 14:91271004-91271026 GTGGAGGGGCGCAGAGGGAGGGG + Intergenic
1121104428 14:91271179-91271201 GTGGAGGGGCGCAGAGGGAGGGG + Intergenic
1121711617 14:96042909-96042931 CAGGAGTGGCCAAGAGGACAGGG + Intronic
1202851455 14_GL000225v1_random:23049-23071 CTGGTGGGACGAAGAGGAAGGGG - Intergenic
1202852336 14_GL000225v1_random:29752-29774 CCGGAGTGACGAAGAGGAAGGGG - Intergenic
1202856925 14_GL000225v1_random:57783-57805 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1202859740 14_GL000225v1_random:73513-73535 CTGGAGAGCCTAAGAGGAAGGGG + Intergenic
1202863534 14_GL000225v1_random:100463-100485 CTGGATAGACGAAGAGGAAGGGG + Intergenic
1202865366 14_GL000225v1_random:113923-113945 CCGGAGAGACGAAGAGGAAGGGG + Intergenic
1124354570 15:28985158-28985180 CTGGCTGGGAGAAGAGGAGGAGG + Intronic
1125418190 15:39474984-39475006 CTGCTGGGGCAAAGAGGAAGAGG + Intergenic
1125508477 15:40280899-40280921 CTGGAGGGTTGAGGAGGAAGGGG - Intronic
1125921111 15:43526519-43526541 TTGGAGGGGCAGAGAGGATGTGG + Exonic
1126102683 15:45129402-45129424 GTGGGGGGGCGCAGAGGAGGAGG - Intronic
1126302160 15:47209690-47209712 CTGGAGAGGCGACGGGGACCAGG - Intronic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1127683112 15:61316617-61316639 ATGTAGGGGAGATGAGGACGGGG - Intergenic
1127982663 15:64046198-64046220 CTGGCGGGGCGAAGAGATCCGGG - Intronic
1128414265 15:67429756-67429778 CAGGAGGGGCAAAGGGGACTGGG + Intronic
1128999431 15:72320018-72320040 GTGGAGGGGCGTAGAGGGGGTGG + Exonic
1130996254 15:88906005-88906027 CTGGGAGGGTGAAGAGGACTTGG + Intronic
1131364548 15:91827348-91827370 CTGGAGGAACAAACAGGACGTGG - Intergenic
1132055601 15:98648751-98648773 CGGGAGGGGCGTGGAGGGCGCGG - Intergenic
1134070422 16:11256606-11256628 CTGCAGGGGAGGAGAGGACAGGG - Intronic
1134191247 16:12122646-12122668 CTGGAGCGGCAGAGAGGACATGG + Intronic
1134846993 16:17448684-17448706 GTGGAGGGGGGAGGAGGAAGAGG + Intronic
1135547357 16:23375164-23375186 CTGGTGGGGCGAGGAAGAGGAGG - Intronic
1135589038 16:23692091-23692113 CTGGAGGATGGAAGAGGAGGAGG + Intronic
1135816846 16:25642385-25642407 GTGAAGAGGTGAAGAGGACGTGG + Intergenic
1135920304 16:26643445-26643467 GTGGAGGGAAGAAGAGGAGGAGG - Intergenic
1138418843 16:56886487-56886509 CTGGAGGGGCACAGGGGACCAGG + Intronic
1140228466 16:73097729-73097751 CTGGAGGGGCCACGGGGACGGGG - Intergenic
1141632404 16:85295442-85295464 GTGGATGGGCAAAAAGGACGCGG - Intergenic
1142127328 16:88416761-88416783 CTGGAAGGGCGAAGGGTGCGTGG - Intergenic
1142253870 16:89004597-89004619 GTGGAGGGGCCAGGAGGAGGGGG + Intergenic
1142508066 17:378270-378292 CTGGAGGTGCCCAGAGGAGGAGG + Intronic
1142557502 17:789904-789926 CTGGAGGGGAGAAGGGAAAGGGG - Intronic
1143254834 17:5548317-5548339 CAGGAGGGGAGATGAGGACAGGG - Intronic
1146926678 17:36750457-36750479 GTGGAGGGCCGTAGAGGATGGGG - Intergenic
1147577265 17:41609995-41610017 CTGACGGCTCGAAGAGGACGAGG + Exonic
1147947178 17:44086738-44086760 CTGGAGGGGAGAATGGGAGGGGG + Intronic
1148126913 17:45241931-45241953 CTGTGGGGGCGCAGAGGGCGGGG - Exonic
1148220493 17:45858461-45858483 AGGGAGGGGAGAAGAGGAAGTGG - Intergenic
1148693121 17:49544478-49544500 CTGGAGGGGAGAAGAGGAGATGG + Intergenic
1148933049 17:51142692-51142714 CTGAAGGGACGAAGAAGACCTGG + Intergenic
1152095540 17:78269739-78269761 CGGGAGGGGAGAGGAGGAAGAGG - Intergenic
1152135595 17:78501455-78501477 CTGGAGGGGGAAAGAGGGCCAGG - Intronic
1152336710 17:79703085-79703107 GAGGAGGGGGGAAGAGGAAGAGG - Intergenic
1152471617 17:80492708-80492730 CTGGAGGGGCACAGAGGACGGGG - Intergenic
1155434602 18:25798556-25798578 CTGGAATGGCTAAGAGGATGTGG - Intergenic
1156257208 18:35409771-35409793 CTTGAGGGGCAAAGGGAACGTGG + Intergenic
1156409392 18:36813202-36813224 CTGAAGGGGCAAAGAGAACTAGG + Intronic
1157473608 18:48008010-48008032 CTGGAGAGGGGAAGAGCACAGGG - Intergenic
1157589055 18:48825217-48825239 CTGGAGGGGAGAAGAGCCAGGGG - Intronic
1158380083 18:56920044-56920066 GTGAAGGGGAGAAGAGGGCGGGG - Intronic
1160965309 19:1744723-1744745 CTGGAGGGGGGAAGAGGAGGAGG - Intergenic
1161333723 19:3700133-3700155 CTGGAGCCGCGGGGAGGACGGGG - Intronic
1161370686 19:3909319-3909341 CTGCAGGGTGGGAGAGGACGTGG - Intronic
1161829308 19:6591029-6591051 CAGGAGGGGCGATGGGGGCGCGG + Exonic
1162349840 19:10142138-10142160 CTGGAGCGACGAGGAGGCCGTGG - Exonic
1162367165 19:10256685-10256707 CTGGAGGCACAAAGAGGAGGGGG - Intronic
1162783527 19:13020164-13020186 CTGGAGGGGAGAAGAGAAGGAGG + Intronic
1163570062 19:18076012-18076034 CTGGAGGCCCTAAGAGGACAGGG - Intronic
1164761746 19:30733386-30733408 CTGGAGGGGGCAACAGCACGTGG - Intergenic
1165466643 19:35978719-35978741 CTGGAGAGACTAAGAGGACGAGG - Intergenic
1165808366 19:38595898-38595920 CTGGAGGGGTGGGGAGGAAGGGG + Intronic
1165955498 19:39499530-39499552 CTGGAGGGGAGAGGAGGTGGAGG - Intronic
1166269783 19:41706939-41706961 CTCGGAGGGCGAGGAGGACGTGG - Intronic
1166856805 19:45786289-45786311 GCGGAGCGGCGAAGAGGAGGAGG - Exonic
1166998588 19:46731761-46731783 CTGGAGGGAGGAACAGGAGGAGG - Intronic
1167645483 19:50703121-50703143 CTGGAGGGAGGATGAGGAAGGGG - Intronic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168440268 19:56359491-56359513 CTGGAGGTGCAAAGAGGAGCTGG + Intronic
1202704509 1_KI270713v1_random:13294-13316 ATGGAGGCGCGAGGAGGAGGTGG - Intergenic
925907306 2:8547177-8547199 CTGGTGGGACGTAGAGTACGAGG - Intergenic
927155097 2:20216765-20216787 CTGGAGGGCCGAGGAGCTCGTGG - Intronic
927490729 2:23519317-23519339 CTGGGGGGGAGGGGAGGACGGGG - Intronic
927721774 2:25387721-25387743 CTGGAGGTGAGAAGGGGAGGTGG - Intronic
929463687 2:42125835-42125857 CAGGAGGGGCCATGAGGAGGGGG + Intergenic
933589320 2:84214505-84214527 CTGAAGGGGCAAAGAGGGAGAGG + Intergenic
933658291 2:84906444-84906466 CTGGGGTCTCGAAGAGGACGGGG - Exonic
934932646 2:98440739-98440761 CTGGAGGGACAAAAAGGATGTGG - Intergenic
934965562 2:98718874-98718896 GTGGAGGGGCCAAGAGGTTGAGG - Intronic
935574209 2:104692117-104692139 CTGGAGGGGAGAGGAGAATGAGG + Intergenic
935753263 2:106257404-106257426 CTGGAGGGGTGAAGAGGGGAAGG - Intergenic
937037102 2:118791334-118791356 CTGAAGGGGCTATGAGGAGGTGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
941269426 2:163407355-163407377 CTGGTGGGGCAAAGAGGTCTTGG - Intergenic
942046333 2:172101425-172101447 CTGCAGGGGCGAGGAGAGCGCGG - Intronic
945639140 2:212400241-212400263 CTGGAGTGGGGAAGAGGATTTGG + Intronic
946169435 2:217885856-217885878 CTGGAGGGGAGATGAGGGAGGGG + Intronic
946426125 2:219598071-219598093 CTGGGGGGGGAAAGAGGAAGCGG - Intronic
948272764 2:236686972-236686994 CTGGAGGGGCCACGAGGACAGGG + Intergenic
1169345238 20:4823656-4823678 GGGGAGGGGAGAAGAGGAGGGGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172951031 20:38723775-38723797 CTGGACGGGCGGAGAGAACCCGG + Intergenic
1173006336 20:39142460-39142482 AGGGAGGGGGGAAGAAGACGAGG + Intergenic
1173278733 20:41607694-41607716 CTGGATGGGCCAAGAGGGAGGGG + Intronic
1173873900 20:46357835-46357857 GCAGAGGGGCGAAGAGGAAGAGG - Intronic
1173891002 20:46510244-46510266 CTTGAGGTGGGAAGAGGAAGGGG + Intronic
1175183983 20:57167441-57167463 CAGGAGGGGGGAAGATGAAGAGG + Intergenic
1180063997 21:45404062-45404084 CTCCAGGGGCGGAGAGGAGGTGG + Intergenic
1180898141 22:19352245-19352267 GTGGCGGGGCGGAGAGGAGGTGG + Intronic
1180957312 22:19746794-19746816 CTGGCTGGCCGAAGAGGAAGGGG - Intergenic
1182585671 22:31343158-31343180 CTGGAGGGGGGAAGAGAAATGGG + Intronic
1183390975 22:37545667-37545689 CGGGAGGGGAGACGAGGACAGGG + Intergenic
1183628396 22:39018538-39018560 CTGGAAGAGCGAGGAGGAAGCGG - Exonic
1183732078 22:39624232-39624254 CAGGAGGAGCAAAGAGGACCTGG - Intronic
1184453979 22:44598868-44598890 AAGGAGGGGAGAAGAGGAGGAGG + Intergenic
1184660915 22:45965138-45965160 CTGGAGGTGTGAAGAGGATGTGG - Intronic
950864167 3:16175553-16175575 CTGGGGGGCTGATGAGGACGGGG + Exonic
952281125 3:31924305-31924327 CTGGAGTGGAAAAGAGTACGTGG + Intronic
953042954 3:39271122-39271144 CTGCAGAGCTGAAGAGGACGTGG - Intronic
953571268 3:44073498-44073520 CAGCAGGTGCCAAGAGGACGTGG + Intergenic
955379068 3:58422260-58422282 CTGGAGGGGAGAGGAGGTCTAGG - Intronic
955768326 3:62367779-62367801 CAGGATGGGCGAGGAGGACTTGG - Intergenic
960055227 3:113272387-113272409 CTGGAGGGGCAAGGAGGGCAAGG - Intronic
961487522 3:127227292-127227314 CTGGAGCTGCGAGGAGGAGGAGG - Intergenic
961566629 3:127768715-127768737 CTGGAGGGGTGGACAGGACAGGG - Intronic
963870354 3:150408915-150408937 GTGGGAGGGCGAAGAGGAGGAGG - Exonic
964374429 3:156035582-156035604 CAGGAGGGGGGAGGAGGAGGAGG - Intergenic
968640408 4:1711911-1711933 CTGGAGGCCCGAAGACGCCGAGG - Exonic
968700918 4:2058210-2058232 CTGGAGAGGGGCAGGGGACGGGG - Intergenic
968962821 4:3753796-3753818 CTGGTGGGGGGCAGGGGACGTGG + Intergenic
969131367 4:4993331-4993353 CAGGAGGGCTGAAGAGGAGGTGG - Intergenic
970332651 4:15002348-15002370 GGGGAGGGGCGACGGGGACGCGG + Intergenic
970598243 4:17619268-17619290 CTGGATGGCCTAAGAGGACAAGG - Intronic
970720160 4:18977604-18977626 CTGGAGGTGGGAAGATCACGAGG + Intergenic
970992897 4:22234160-22234182 CTGGAGAGGCGAATAGCAGGTGG - Intergenic
971286098 4:25291365-25291387 CTGAAGTGGAGAAGGGGACGGGG + Intergenic
975281709 4:72569263-72569285 CGGGAGGAGCGAAGGGGAGGAGG + Intergenic
975330131 4:73103341-73103363 CTGGAGGGTGGAACAGGAGGAGG + Intronic
975497098 4:75046906-75046928 CTGGAGGGGAGAACAGGTAGGGG - Exonic
976151432 4:82096375-82096397 TGGGAGGGGTGAAGAGGAAGTGG + Intergenic
979231456 4:118352768-118352790 TTGGAGCGGAGAAGAGGAGGGGG + Exonic
985451962 4:190067586-190067608 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985452949 4:190070877-190070899 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985453938 4:190074170-190074192 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985454926 4:190077463-190077485 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985455912 4:190080760-190080782 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985456897 4:190084054-190084076 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985457885 4:190087350-190087372 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985458873 4:190090647-190090669 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985463125 4:190173410-190173432 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985771396 5:1814025-1814047 GTGGTGGGGAGAAGAGGGCGTGG + Intronic
985875547 5:2591390-2591412 CTGGAGGGGCAGAGTGGACGTGG + Intergenic
987147310 5:15004953-15004975 CTGGAGGGGCTGAGAGCATGGGG + Intergenic
995430946 5:112076153-112076175 CTGGAGGGGCATATAGGACAGGG + Intergenic
995462841 5:112420325-112420347 TGGGTGGGGAGAAGAGGACGCGG + Intergenic
997476070 5:134143268-134143290 CTGGAGTGGAGAATAGGATGTGG - Intronic
998071600 5:139202103-139202125 CTGGGTGGGCAAAGAGGAAGGGG - Intronic
998386035 5:141757685-141757707 CTGGAGCAGGGAAGAGGACAGGG + Intergenic
998505498 5:142668897-142668919 ATGGAGGGCTGAAGAGGAAGGGG + Intronic
998969150 5:147572256-147572278 TTGGAGGGGAGAAGGGGACTAGG + Intergenic
999040289 5:148402062-148402084 CTTGAGAGGCGAAGAGTAAGGGG + Exonic
999135191 5:149314025-149314047 CTGGAGGGGCAAGAAGGATGAGG + Intronic
999404649 5:151296269-151296291 CTGGAGGGGAGAGGAGAAAGGGG + Intronic
1000120631 5:158194647-158194669 CTGGAGGGAGGGAGAGGAGGAGG - Intergenic
1002301121 5:178257699-178257721 CTGGAGGGGCAAGGAGGGTGGGG - Intronic
1003459227 6:6314570-6314592 GTGGAGTGGGGAAGAGGATGAGG - Intronic
1004865637 6:19851441-19851463 CTGCAGTGGAGAAGAGGAGGAGG - Intergenic
1006239417 6:32664716-32664738 CGGGAGGGGCGATGGGGGCGAGG - Intronic
1006925790 6:37654535-37654557 CTGGTGGTGCTAAGAGGACAAGG + Exonic
1007259771 6:40555372-40555394 GTGGAGGGGAGAGGAGGAGGAGG - Intronic
1007301637 6:40872137-40872159 CTGGAGTGGTGAAAAGGAAGGGG - Intergenic
1008367425 6:50698735-50698757 CTGGAGGGGTGGAGAGGTGGGGG + Intergenic
1009562087 6:65259246-65259268 CAGGAGGGAAGAAGAGGACATGG - Intronic
1009808810 6:68635434-68635456 CTGCAGGGGGGAGGAGGAGGAGG + Exonic
1012846452 6:104395554-104395576 TTGGAGGGGAGAAGAGCAGGAGG - Intergenic
1013079767 6:106801934-106801956 GTGGAGGGGACAAGGGGACGTGG + Intergenic
1013167212 6:107605041-107605063 GTGGAGGGGGGAGGAGGAAGAGG - Intronic
1014485116 6:121989681-121989703 GTGGAGTGGAGAAGAGGAAGTGG - Intergenic
1016990671 6:149925816-149925838 CTGGTGGGGTGAGGAGCACGGGG + Intergenic
1016992317 6:149938656-149938678 CTGGTGGGGTGAAGAGCACGAGG - Intergenic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1018849966 6:167579834-167579856 CTGGAGAGACAAAGAGGAGGGGG + Intergenic
1020082091 7:5291619-5291641 CAGGAGGGGCGAGGAGGAGGGGG + Intronic
1020125442 7:5530448-5530470 CTGCACGGGCGAAGGGGCCGCGG + Intronic
1021834891 7:24660315-24660337 CTGGTGGGGGGATGAGGACTAGG - Intronic
1022282706 7:28927105-28927127 CTGGCTGGGGGAAGTGGACGTGG - Intergenic
1025149533 7:56537957-56537979 CTGGAGGGACGCGGAGGAGGAGG + Intergenic
1025196828 7:56940521-56940543 CAGGAGGGGCGAGGAGGAGGGGG - Intergenic
1025675120 7:63636416-63636438 CAGGAGGGGCGAGGAGGAGGGGG + Intergenic
1025813396 7:64889325-64889347 CTGTTGGGGCGGAGGGGACGCGG - Intronic
1026477008 7:70744941-70744963 CTGGAGGGGCGATGATGAAAAGG - Intronic
1027976394 7:85161508-85161530 CTGGAGGGGCAAAGAAGACAGGG + Intronic
1028831455 7:95331234-95331256 CTGCAGGGGAGAGGAGGATGGGG + Intergenic
1031359529 7:120831638-120831660 CTGGTAGGGTGAAGAGGAGGAGG + Intronic
1031604188 7:123748860-123748882 CCGGAGCGGGGAGGAGGACGAGG + Exonic
1032543670 7:132724754-132724776 CTGGAGGGGTGAGCAGGACATGG - Intronic
1034105636 7:148487170-148487192 CTGGGGGTGGGAAGAGGAGGCGG + Intergenic
1034927228 7:155131792-155131814 CTGGGGTGGAGAAGAGGATGTGG - Intergenic
1037487223 8:19358936-19358958 GTGGAGGGGCGGAGGGGCCGAGG - Intronic
1037891899 8:22628043-22628065 TGGGAGGGGCGAAGAGGAGAAGG + Intronic
1038449645 8:27631839-27631861 CTGGAGTAGAGAAGAGGACAAGG - Intergenic
1039453915 8:37695939-37695961 CTGGGGGGGCGGGGAGGGCGGGG - Exonic
1040940786 8:52830723-52830745 CTGGAGGAGAGAGGAGGAAGTGG - Intergenic
1048219050 8:132524792-132524814 CTGGAGGGATGAAGAGGAGGCGG - Intergenic
1049386062 8:142343759-142343781 GAGGAGGGGAGAAGAGGAGGAGG + Intronic
1049555355 8:143278760-143278782 CTGGAGGGGCGGGGAGGGGGCGG + Intergenic
1049621341 8:143599604-143599626 CATGGGGGGCGGAGAGGACGAGG + Exonic
1049988340 9:971917-971939 CTGGAGGGGCGCCGAGGGGGAGG - Intergenic
1051287377 9:15510740-15510762 CTGTAGCGGGGAAGTGGACGCGG - Intronic
1052508589 9:29384905-29384927 CTGGAGAGGTGGAGAGGATGTGG + Intergenic
1053003102 9:34588689-34588711 CTGGAGGGGGGAGGGGGACAAGG + Intronic
1056998161 9:91483367-91483389 CTGGAGAGGACAAGAGGACCGGG + Intergenic
1057551134 9:96051450-96051472 CTGGGGGGGTGAAGGGGGCGGGG + Intergenic
1059471011 9:114504984-114505006 CCGGAGGCGCGAAGACGGCGGGG + Intronic
1060208582 9:121697137-121697159 GTGGAGTGGGGAAGAGGAAGTGG + Intronic
1060497144 9:124127054-124127076 CTGGAGGGCTGGAGAGGATGCGG + Intergenic
1060826168 9:126689262-126689284 CTGGTGGGGCGAAGTGGGCAGGG - Intronic
1061721875 9:132556921-132556943 CTGGCGTGGCGAAGGAGACGCGG - Intronic
1062267450 9:135693787-135693809 CTGGAGGGTCGAGGAGGCAGTGG - Exonic
1062316142 9:135967748-135967770 CTGGAGGGGCGAGGTGGTGGGGG + Intergenic
1062409711 9:136417148-136417170 CTGGGGGAGCGCAGAGGCCGTGG + Exonic
1062726422 9:138076514-138076536 CTGGAGGGGCCAAGAGGCCATGG + Intronic
1203738976 Un_GL000216v2:162241-162263 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1203740793 Un_GL000216v2:175549-175571 CTGGATAGACGAAGAGGAAGGGG - Intergenic
1190869927 X:54415967-54415989 CTGGAGGGGCCAAGGGGGAGGGG + Intergenic
1196698070 X:118635170-118635192 ATGGAGGGGCAAGGAGGATGAGG - Intronic
1196842463 X:119871346-119871368 CTTGAGCAGCGAAGAGGAAGAGG - Exonic
1199742831 X:150751656-150751678 GTTGAGGGGAGAAGAGGACCTGG - Intronic
1201179454 Y:11332015-11332037 CCGGAGAGACGAAGAGGAAGGGG - Intergenic