ID: 1127518607

View in Genome Browser
Species Human (GRCh38)
Location 15:59720861-59720883
Sequence CCTTCAAAGAAGTGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127518602_1127518607 22 Left 1127518602 15:59720816-59720838 CCATTCCAGGCTATGAAGATAAC No data
Right 1127518607 15:59720861-59720883 CCTTCAAAGAAGTGGAAAGCAGG No data
1127518603_1127518607 17 Left 1127518603 15:59720821-59720843 CCAGGCTATGAAGATAACAAGAT No data
Right 1127518607 15:59720861-59720883 CCTTCAAAGAAGTGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127518607 Original CRISPR CCTTCAAAGAAGTGGAAAGC AGG Intergenic
No off target data available for this crispr