ID: 1127521076 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:59743517-59743539 |
Sequence | CTCTCAGACAAACCTTCTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1127521076_1127521078 | 0 | Left | 1127521076 | 15:59743517-59743539 | CCATCAGAAGGTTTGTCTGAGAG | No data | ||
Right | 1127521078 | 15:59743540-59743562 | CTAAGGATCTGCCTCCAAGTTGG | No data | ||||
1127521076_1127521081 | 17 | Left | 1127521076 | 15:59743517-59743539 | CCATCAGAAGGTTTGTCTGAGAG | No data | ||
Right | 1127521081 | 15:59743557-59743579 | AGTTGGCACAATCACACCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1127521076 | Original CRISPR | CTCTCAGACAAACCTTCTGA TGG (reversed) | Intergenic | ||