ID: 1127521078

View in Genome Browser
Species Human (GRCh38)
Location 15:59743540-59743562
Sequence CTAAGGATCTGCCTCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127521076_1127521078 0 Left 1127521076 15:59743517-59743539 CCATCAGAAGGTTTGTCTGAGAG No data
Right 1127521078 15:59743540-59743562 CTAAGGATCTGCCTCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127521078 Original CRISPR CTAAGGATCTGCCTCCAAGT TGG Intergenic
No off target data available for this crispr