ID: 1127524374

View in Genome Browser
Species Human (GRCh38)
Location 15:59777617-59777639
Sequence AATGTTCACCAGGCTGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127524374_1127524378 1 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524378 15:59777641-59777663 CAGTTCCGAAAGGTGCTTTGAGG No data
1127524374_1127524381 28 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524381 15:59777668-59777690 ATGTGGCACTAACTATATCTAGG No data
1127524374_1127524377 -9 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524377 15:59777631-59777653 GTGAACATTACAGTTCCGAAAGG No data
1127524374_1127524380 11 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524380 15:59777651-59777673 AGGTGCTTTGAGGTTTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127524374 Original CRISPR AATGTTCACCAGGCTGTGTA GGG (reversed) Intergenic
No off target data available for this crispr