ID: 1127524378

View in Genome Browser
Species Human (GRCh38)
Location 15:59777641-59777663
Sequence CAGTTCCGAAAGGTGCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127524375_1127524378 0 Left 1127524375 15:59777618-59777640 CCTACACAGCCTGGTGAACATTA No data
Right 1127524378 15:59777641-59777663 CAGTTCCGAAAGGTGCTTTGAGG No data
1127524374_1127524378 1 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524378 15:59777641-59777663 CAGTTCCGAAAGGTGCTTTGAGG No data
1127524372_1127524378 30 Left 1127524372 15:59777588-59777610 CCAATAGAGAAAACTGTGGACTA No data
Right 1127524378 15:59777641-59777663 CAGTTCCGAAAGGTGCTTTGAGG No data
1127524376_1127524378 -9 Left 1127524376 15:59777627-59777649 CCTGGTGAACATTACAGTTCCGA No data
Right 1127524378 15:59777641-59777663 CAGTTCCGAAAGGTGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127524378 Original CRISPR CAGTTCCGAAAGGTGCTTTG AGG Intergenic
No off target data available for this crispr