ID: 1127524380

View in Genome Browser
Species Human (GRCh38)
Location 15:59777651-59777673
Sequence AGGTGCTTTGAGGTTTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127524375_1127524380 10 Left 1127524375 15:59777618-59777640 CCTACACAGCCTGGTGAACATTA No data
Right 1127524380 15:59777651-59777673 AGGTGCTTTGAGGTTTGATGTGG No data
1127524376_1127524380 1 Left 1127524376 15:59777627-59777649 CCTGGTGAACATTACAGTTCCGA No data
Right 1127524380 15:59777651-59777673 AGGTGCTTTGAGGTTTGATGTGG No data
1127524374_1127524380 11 Left 1127524374 15:59777617-59777639 CCCTACACAGCCTGGTGAACATT No data
Right 1127524380 15:59777651-59777673 AGGTGCTTTGAGGTTTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127524380 Original CRISPR AGGTGCTTTGAGGTTTGATG TGG Intergenic
No off target data available for this crispr