ID: 1127524541

View in Genome Browser
Species Human (GRCh38)
Location 15:59779332-59779354
Sequence GGTGCATTAGTGCTTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127524534_1127524541 19 Left 1127524534 15:59779290-59779312 CCTGGTGGTGGTAAAAGCTATCC No data
Right 1127524541 15:59779332-59779354 GGTGCATTAGTGCTTCTTGATGG No data
1127524539_1127524541 -2 Left 1127524539 15:59779311-59779333 CCTAATGGCAGGTGGCGGCATGG No data
Right 1127524541 15:59779332-59779354 GGTGCATTAGTGCTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127524541 Original CRISPR GGTGCATTAGTGCTTCTTGA TGG Intergenic
No off target data available for this crispr