ID: 1127525935

View in Genome Browser
Species Human (GRCh38)
Location 15:59792115-59792137
Sequence AGGGAGGGCCTAATGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127525935_1127525943 -8 Left 1127525935 15:59792115-59792137 CCCCCAGCCATTAGGCCCTCCCT No data
Right 1127525943 15:59792130-59792152 CCCTCCCTGGCCTTGAAGGTAGG No data
1127525935_1127525950 4 Left 1127525935 15:59792115-59792137 CCCCCAGCCATTAGGCCCTCCCT No data
Right 1127525950 15:59792142-59792164 TTGAAGGTAGGGCCTCACCAGGG 0: 2
1: 12
2: 83
3: 249
4: 483
1127525935_1127525945 -7 Left 1127525935 15:59792115-59792137 CCCCCAGCCATTAGGCCCTCCCT No data
Right 1127525945 15:59792131-59792153 CCTCCCTGGCCTTGAAGGTAGGG No data
1127525935_1127525953 25 Left 1127525935 15:59792115-59792137 CCCCCAGCCATTAGGCCCTCCCT No data
Right 1127525953 15:59792163-59792185 GGTTCTGCCTCCTTCCACCCAGG No data
1127525935_1127525949 3 Left 1127525935 15:59792115-59792137 CCCCCAGCCATTAGGCCCTCCCT No data
Right 1127525949 15:59792141-59792163 CTTGAAGGTAGGGCCTCACCAGG 0: 2
1: 10
2: 113
3: 312
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127525935 Original CRISPR AGGGAGGGCCTAATGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr