ID: 1127530136

View in Genome Browser
Species Human (GRCh38)
Location 15:59835593-59835615
Sequence CTCCATCTACAGAATGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127530132_1127530136 0 Left 1127530132 15:59835570-59835592 CCCCTCTCACTGGGTCTTGCTTT No data
Right 1127530136 15:59835593-59835615 CTCCATCTACAGAATGACCAGGG No data
1127530134_1127530136 -2 Left 1127530134 15:59835572-59835594 CCTCTCACTGGGTCTTGCTTTCT No data
Right 1127530136 15:59835593-59835615 CTCCATCTACAGAATGACCAGGG No data
1127530133_1127530136 -1 Left 1127530133 15:59835571-59835593 CCCTCTCACTGGGTCTTGCTTTC No data
Right 1127530136 15:59835593-59835615 CTCCATCTACAGAATGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127530136 Original CRISPR CTCCATCTACAGAATGACCA GGG Intergenic
No off target data available for this crispr