ID: 1127540758

View in Genome Browser
Species Human (GRCh38)
Location 15:59936646-59936668
Sequence ATATTGTACTAGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127540758_1127540764 18 Left 1127540758 15:59936646-59936668 CCCTCCCTCTTCTAGTACAATAT No data
Right 1127540764 15:59936687-59936709 CATGTGAATAACATTTCCACGGG No data
1127540758_1127540765 19 Left 1127540758 15:59936646-59936668 CCCTCCCTCTTCTAGTACAATAT No data
Right 1127540765 15:59936688-59936710 ATGTGAATAACATTTCCACGGGG No data
1127540758_1127540763 17 Left 1127540758 15:59936646-59936668 CCCTCCCTCTTCTAGTACAATAT No data
Right 1127540763 15:59936686-59936708 TCATGTGAATAACATTTCCACGG No data
1127540758_1127540762 -9 Left 1127540758 15:59936646-59936668 CCCTCCCTCTTCTAGTACAATAT No data
Right 1127540762 15:59936660-59936682 GTACAATATTTTATATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127540758 Original CRISPR ATATTGTACTAGAAGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr