ID: 1127543676

View in Genome Browser
Species Human (GRCh38)
Location 15:59968683-59968705
Sequence TTATTACCAGGGCTCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127543676_1127543680 19 Left 1127543676 15:59968683-59968705 CCTTGCAGGAGCCCTGGTAATAA No data
Right 1127543680 15:59968725-59968747 TGTAGAAAGAATGAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127543676 Original CRISPR TTATTACCAGGGCTCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr