ID: 1127545413

View in Genome Browser
Species Human (GRCh38)
Location 15:59990119-59990141
Sequence GGTCACACAATAGCAAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127545413_1127545418 16 Left 1127545413 15:59990119-59990141 CCCTGCTTTGCTATTGTGTGACC No data
Right 1127545418 15:59990158-59990180 CTCAGAAATGTATACAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127545413 Original CRISPR GGTCACACAATAGCAAAGCA GGG (reversed) Intergenic
No off target data available for this crispr