ID: 1127546086

View in Genome Browser
Species Human (GRCh38)
Location 15:59995328-59995350
Sequence CGGGATCCAAGCGTCCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127546086_1127546096 22 Left 1127546086 15:59995328-59995350 CCGGGGAGGACGCTTGGATCCCG No data
Right 1127546096 15:59995373-59995395 ACAACCCTCAGGAAGCGCTGCGG No data
1127546086_1127546089 -5 Left 1127546086 15:59995328-59995350 CCGGGGAGGACGCTTGGATCCCG No data
Right 1127546089 15:59995346-59995368 TCCCGAAAATGACGGGATCCAGG No data
1127546086_1127546092 11 Left 1127546086 15:59995328-59995350 CCGGGGAGGACGCTTGGATCCCG No data
Right 1127546092 15:59995362-59995384 ATCCAGGTCCCACAACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127546086 Original CRISPR CGGGATCCAAGCGTCCTCCC CGG (reversed) Intergenic
No off target data available for this crispr