ID: 1127550320

View in Genome Browser
Species Human (GRCh38)
Location 15:60031207-60031229
Sequence ATTGCCTATTAAGGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127550320 Original CRISPR ATTGCCTATTAAGGTAAAGC AGG Intronic
904516961 1:31063798-31063820 CTTGCCTCTTTAGGTAAAGCAGG - Intronic
909996583 1:82287454-82287476 ATTGCTTATTAATGAAAAGATGG + Intergenic
915757106 1:158272845-158272867 ATTGCCCATTCAAGTAAAACTGG + Intergenic
918099168 1:181358728-181358750 ATTCCCCATCAATGTAAAGCAGG + Intergenic
1063578994 10:7288292-7288314 GTTGCCATATAAGGTAAAGCTGG - Intronic
1066987078 10:42476843-42476865 ATTGTGTATTAATGTAATGCTGG + Intergenic
1071028774 10:81146657-81146679 ATTAACTATTAATGTAAATCTGG - Intergenic
1072479077 10:95793245-95793267 ATTGCCTAATAAGGAATAGACGG + Intronic
1073593518 10:104778398-104778420 TTTGCCTATTCAGATAAATCTGG + Intronic
1078580205 11:12533742-12533764 ATTTACTATTAAGTGAAAGCAGG + Intergenic
1079458089 11:20653959-20653981 ATTACCTTTTAAAGTGAAGCTGG - Intronic
1080704948 11:34681727-34681749 ATTGACTATTTAGGAAAATCTGG + Intergenic
1080827490 11:35860416-35860438 GTTGAATATTAAGGTCAAGCTGG - Intergenic
1081859306 11:46323404-46323426 ATTGCCTCTTAATGCACAGCTGG - Intergenic
1081901222 11:46629700-46629722 AGTGCTTATTAAGATTAAGCAGG - Intronic
1086159203 11:83702487-83702509 ATTGCCCATGAAGGTGAAGTAGG + Intronic
1086387851 11:86327749-86327771 ATTCCCTATTAATGGAAATCTGG + Intronic
1086699306 11:89881848-89881870 ATCCCATAATAAGGTAAAGCAGG - Intergenic
1086706865 11:89962666-89962688 ATCCCATAATAAGGTAAAGCAGG + Intergenic
1087073318 11:94103718-94103740 ATTGCCTATTAAAGAAAAAAAGG + Intronic
1089114930 11:116086975-116086997 GTTGCCTGTTCAGGGAAAGCTGG + Intergenic
1090786429 11:130052313-130052335 ATTGCCTATAAAGGGTAGGCAGG - Intergenic
1091474747 12:761785-761807 ATTGTGGATTAAGGTAAATCGGG + Intronic
1092567005 12:9676657-9676679 TTTTCCTATTAGGATAAAGCTGG + Intronic
1093913139 12:24769728-24769750 ATTGATTATTAAGATTAAGCTGG - Intergenic
1094009809 12:25795416-25795438 ATTGCCTTTTAAGGTAACAGGGG - Intergenic
1095423471 12:42049519-42049541 ACTCCCTATTGAGGTAAACCTGG + Intergenic
1099516449 12:83601795-83601817 ATTGACTATTATGTTAAAACAGG - Intergenic
1107654969 13:42582917-42582939 ATTTCATATTAAGGTAATTCTGG + Intronic
1112286039 13:98105241-98105263 TTTTCCTTTTAAGGAAAAGCCGG + Intergenic
1112572267 13:100603855-100603877 ATTTCATTTTAAGGTAAAGGAGG + Intergenic
1112938144 13:104826425-104826447 ATTGCCATTAAAGGTAAAGATGG - Intergenic
1113358410 13:109605290-109605312 ATTGCTTTTTAAATTAAAGCAGG - Intergenic
1114848893 14:26359057-26359079 AGAGCCTATCAAGGCAAAGCTGG - Intergenic
1115298923 14:31862262-31862284 TTTGCATATTAGGGTAATGCTGG - Intergenic
1119081086 14:71694377-71694399 ATTGCATATAAATGAAAAGCTGG + Intronic
1125104832 15:35958235-35958257 ATTGCCTCTTCAGACAAAGCTGG - Intergenic
1126388716 15:48121839-48121861 ATTTCCTGTTAAGGAAAAGGAGG - Exonic
1126652658 15:50940096-50940118 ATTGACTAATAAGATAAGGCAGG - Intronic
1126695164 15:51319817-51319839 CCTGACTATTAAGGTAGAGCTGG - Intronic
1127550320 15:60031207-60031229 ATTGCCTATTAAGGTAAAGCAGG + Intronic
1129249424 15:74300660-74300682 ATTTCCTATTAAGCTGAAGTCGG - Intronic
1130015677 15:80184555-80184577 AAAGCCTATTAAAGTAAAACTGG - Intronic
1130627241 15:85528063-85528085 ATTTCCTATTAAGCTAAAAGTGG - Intronic
1137516802 16:49152090-49152112 ATTCAGTATTAAGGTAATGCTGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1145823184 17:27856276-27856298 ATCTCCTATTAAGGGACAGCTGG - Intronic
1156156937 18:34314379-34314401 ATTCCCTACTAAGGGAAAGTGGG - Intergenic
1156783190 18:40877187-40877209 ATTGCCTTTTAAGGGTAGGCAGG + Intergenic
1158196490 18:54891591-54891613 ATTCCCTATTAAGGAAATGCAGG - Exonic
1158692771 18:59675981-59676003 ATGGCCTATGAAGGTAGGGCGGG - Intronic
1159624651 18:70678390-70678412 ATTTCACATTAAGGGAAAGCAGG + Intergenic
1162109317 19:8391489-8391511 ATTGCCCATTTAGGGACAGCTGG + Intronic
1166075389 19:40411155-40411177 AATGCAAATTAAGGTGAAGCAGG - Intronic
1167829310 19:52006017-52006039 ATTGCCAATAAAGGTATACCTGG + Intronic
928464410 2:31508715-31508737 TTTGAGTATTAAGGTAATGCTGG - Intergenic
933950737 2:87327016-87327038 ATTGCCTCTCAGTGTAAAGCAGG + Intergenic
936329041 2:111531562-111531584 ATTGCCTCTCAGTGTAAAGCAGG - Intergenic
940526864 2:154826861-154826883 ATTTCATTTTAATGTAAAGCAGG + Intronic
941176078 2:162199061-162199083 TGTGCCTATTAAGGCAAAGATGG - Intronic
945892072 2:215440296-215440318 AATGCCTATTAAGCGAAAACTGG - Intergenic
946815614 2:223575575-223575597 AGAGTCTATTAAGGTAAAGCTGG + Intergenic
1171086672 20:22244243-22244265 CTTTTCTATTAAAGTAAAGCAGG + Intergenic
1172071274 20:32259149-32259171 ATTGCCTTTATGGGTAAAGCAGG - Intergenic
1178170654 21:30035957-30035979 ATTGCAGATTCAGGGAAAGCTGG + Intergenic
949771518 3:7584355-7584377 ATTTCCTCTTAAGGTAGAACAGG - Intronic
959949935 3:112168620-112168642 AATGCCTATGAAGGCCAAGCTGG - Intronic
960728242 3:120693482-120693504 ATTGCATAGTAAGGTAAAACAGG - Intronic
961021124 3:123508039-123508061 ATTGCCTTTTAAGATAAAAGGGG + Intronic
961286293 3:125807268-125807290 ATTGGATATCAAGGTAATGCTGG + Intergenic
964598685 3:158469829-158469851 ATTACCTATTAACGGAAAACAGG + Intronic
965756051 3:172028409-172028431 ACTGCCTATTAAACTAAATCAGG - Intergenic
966937453 3:184720873-184720895 ATTATCTATTAAGAAAAAGCAGG - Intergenic
970253024 4:14136672-14136694 ACTTCCTACTAAGGAAAAGCAGG - Intergenic
971161864 4:24141547-24141569 ATTGCTTATCAAGCAAAAGCAGG + Intergenic
973340656 4:48999998-49000020 ATTGCCTTTTAAGGGAAAGGAGG - Intronic
974796269 4:66754673-66754695 CTTTGCTATTAAGGTAATGCTGG - Intergenic
975939300 4:79622621-79622643 AATGCCAATTAAAGTAAAACTGG - Intergenic
978122422 4:105095831-105095853 TTTTGCTATTAAGGTAAAACTGG - Intergenic
984499512 4:180541434-180541456 ATTGACTCTTAGGGGAAAGCAGG - Intergenic
992126906 5:73651452-73651474 ATTGATTATTTAGGGAAAGCTGG + Intronic
992997978 5:82350983-82351005 ATTGAATCTTAAGGCAAAGCAGG + Intronic
993206441 5:84886793-84886815 ATTGCCTAGTCAGACAAAGCTGG + Intergenic
993794456 5:92249437-92249459 ACTGCCTAGTAAGGAGAAGCAGG - Intergenic
999939563 5:156527074-156527096 ATTGCCTATCATGGTACAGAAGG + Intronic
1003453543 6:6260252-6260274 ATTGCCTATGAATGCAAAGCAGG + Intronic
1004763218 6:18694343-18694365 AGTTCCTATTAAGGTAAAAATGG - Intergenic
1006382233 6:33706201-33706223 TTTGCTAATTAAGGTAGAGCTGG + Intronic
1007433526 6:41790859-41790881 ATTGGGTATTAAGATAAAGAAGG + Exonic
1008902635 6:56639249-56639271 GTTAACTATTGAGGTAAAGCTGG - Exonic
1008903809 6:56654299-56654321 ATTGCTTATGAAAGAAAAGCTGG - Intronic
1015027241 6:128550011-128550033 TGTGACTATTAAGGGAAAGCAGG + Intergenic
1021323641 7:19241069-19241091 ATTACCTATAAAGGAAAACCTGG - Intergenic
1021794836 7:24243686-24243708 ATTACCTATATAGGAAAAGCAGG - Intergenic
1021919510 7:25470387-25470409 ATTGCATACAAAGGAAAAGCAGG + Intergenic
1022564187 7:31380884-31380906 ATGGCCTATTAAGGAAAAATGGG - Intergenic
1024864032 7:53881900-53881922 TTTGACTAATAAAGTAAAGCAGG - Intergenic
1027473243 7:78598421-78598443 ATGGCCTATTTAGGTAAAGATGG + Intronic
1031991513 7:128202013-128202035 ATTGCCTGTAGAGGAAAAGCAGG + Intergenic
1042570826 8:70162850-70162872 CTTGCCTATTAAGTAACAGCAGG + Exonic
1042740307 8:72036133-72036155 ATACCCTATTAAGGAAAGGCTGG - Intronic
1042756023 8:72211858-72211880 ATGCCCTATTAAGGAAAGGCTGG - Intergenic
1047291256 8:123532295-123532317 ATTGCTTATTAAGGAAAGACTGG + Intronic
1047555302 8:125923012-125923034 ATTGACTATTAAGATAATGAAGG - Intergenic
1051222637 9:14866508-14866530 ATTGCCTACTAAGGAGAATCTGG + Intronic
1051556143 9:18384629-18384651 ATTGCCTATGAAGTTACAGGAGG - Intergenic
1052131405 9:24852801-24852823 ATTGCCAACTAAGGTTAACCTGG + Intergenic
1052154191 9:25163657-25163679 ATTTGATATTAAGGTAATGCTGG - Intergenic
1054174997 9:61869005-61869027 TTTGCCTATTTACGTACAGCAGG + Intergenic
1054449851 9:65398023-65398045 TTTGCCTATTTACGTACAGCAGG + Intergenic
1054662540 9:67711788-67711810 TTTGCCTATTTACGTACAGCAGG - Intergenic
1058087250 9:100761733-100761755 ATTGCCTTTGAATGTACAGCAGG + Intergenic
1060536850 9:124396829-124396851 CTTGCCTAATAAAGAAAAGCTGG + Intronic
1186235762 X:7507804-7507826 ATTTCCTGTTAAGGAAAAGCAGG - Intergenic
1188322959 X:28762958-28762980 CTTGCCTAAAAATGTAAAGCTGG - Intronic
1192622645 X:72694509-72694531 ACTGCCCATCAAGGTAAGGCTGG - Intronic
1196712144 X:118773958-118773980 CTTACCTTTTTAGGTAAAGCAGG - Exonic
1198920104 X:141715820-141715842 ATTGCTGATTAAAGTAAAACAGG + Intergenic
1200698741 Y:6384304-6384326 TTTTGCAATTAAGGTAAAGCAGG + Intergenic
1201035373 Y:9780395-9780417 TTTTGCAATTAAGGTAAAGCAGG - Intergenic
1201333682 Y:12855531-12855553 ATTGACTATTAAGGAGAAACAGG + Intronic