ID: 1127562754

View in Genome Browser
Species Human (GRCh38)
Location 15:60156631-60156653
Sequence TAAGAAAAGCATAATGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127562751_1127562754 15 Left 1127562751 15:60156593-60156615 CCCTAGAACTTAAAGTATAATAA 0: 4964
1: 17988
2: 9381
3: 3577
4: 1832
Right 1127562754 15:60156631-60156653 TAAGAAAAGCATAATGGTGTAGG No data
1127562752_1127562754 14 Left 1127562752 15:60156594-60156616 CCTAGAACTTAAAGTATAATAAT 0: 2970
1: 15762
2: 12945
3: 9507
4: 5498
Right 1127562754 15:60156631-60156653 TAAGAAAAGCATAATGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127562754 Original CRISPR TAAGAAAAGCATAATGGTGT AGG Intergenic
No off target data available for this crispr