ID: 1127570148

View in Genome Browser
Species Human (GRCh38)
Location 15:60233832-60233854
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127570148_1127570152 -6 Left 1127570148 15:60233832-60233854 CCGAAATTGTACCATCGCACTCC No data
Right 1127570152 15:60233849-60233871 CACTCCTGCCTGGGCAACAGAGG No data
1127570148_1127570156 8 Left 1127570148 15:60233832-60233854 CCGAAATTGTACCATCGCACTCC No data
Right 1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG No data
1127570148_1127570153 -5 Left 1127570148 15:60233832-60233854 CCGAAATTGTACCATCGCACTCC No data
Right 1127570153 15:60233850-60233872 ACTCCTGCCTGGGCAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127570148 Original CRISPR GGAGTGCGATGGTACAATTT CGG (reversed) Intergenic
No off target data available for this crispr