ID: 1127570151

View in Genome Browser
Species Human (GRCh38)
Location 15:60233843-60233865
Sequence TTGCCCAGGCAGGAGTGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127570151_1127570156 -3 Left 1127570151 15:60233843-60233865 CCATCGCACTCCTGCCTGGGCAA No data
Right 1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127570151 Original CRISPR TTGCCCAGGCAGGAGTGCGA TGG (reversed) Intergenic
No off target data available for this crispr