ID: 1127570156

View in Genome Browser
Species Human (GRCh38)
Location 15:60233863-60233885
Sequence CAACAGAGGGAGACTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127570148_1127570156 8 Left 1127570148 15:60233832-60233854 CCGAAATTGTACCATCGCACTCC No data
Right 1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG No data
1127570151_1127570156 -3 Left 1127570151 15:60233843-60233865 CCATCGCACTCCTGCCTGGGCAA No data
Right 1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127570156 Original CRISPR CAACAGAGGGAGACTGTCTC AGG Intergenic
No off target data available for this crispr