ID: 1127570274

View in Genome Browser
Species Human (GRCh38)
Location 15:60234878-60234900
Sequence AGCTGATGGTGGGGGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127570274_1127570285 14 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570285 15:60234915-60234937 ATTTGGGCAAACAGATTTTTGGG No data
1127570274_1127570287 16 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570287 15:60234917-60234939 TTGGGCAAACAGATTTTTGGGGG No data
1127570274_1127570283 -2 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570283 15:60234899-60234921 CTCAACTGCTCTAAGAATTTGGG No data
1127570274_1127570286 15 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570286 15:60234916-60234938 TTTGGGCAAACAGATTTTTGGGG No data
1127570274_1127570289 26 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570289 15:60234927-60234949 AGATTTTTGGGGGAAAGCAAGGG No data
1127570274_1127570284 13 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570284 15:60234914-60234936 AATTTGGGCAAACAGATTTTTGG No data
1127570274_1127570288 25 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570288 15:60234926-60234948 CAGATTTTTGGGGGAAAGCAAGG No data
1127570274_1127570282 -3 Left 1127570274 15:60234878-60234900 CCTCCCTACCCCCACCATCAGCT No data
Right 1127570282 15:60234898-60234920 GCTCAACTGCTCTAAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127570274 Original CRISPR AGCTGATGGTGGGGGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr