ID: 1127570515

View in Genome Browser
Species Human (GRCh38)
Location 15:60236808-60236830
Sequence CCATTACCTGTAAGCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127570512_1127570515 3 Left 1127570512 15:60236782-60236804 CCAAAATTTACTTCTGTCTTTAA No data
Right 1127570515 15:60236808-60236830 CCATTACCTGTAAGCCATCAGGG No data
1127570511_1127570515 21 Left 1127570511 15:60236764-60236786 CCTGTAACTTCTGCTTTTCCAAA No data
Right 1127570515 15:60236808-60236830 CCATTACCTGTAAGCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127570515 Original CRISPR CCATTACCTGTAAGCCATCA GGG Intergenic
No off target data available for this crispr