ID: 1127573044

View in Genome Browser
Species Human (GRCh38)
Location 15:60262794-60262816
Sequence TGAGCACTCCAGCCTGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127573044_1127573047 3 Left 1127573044 15:60262794-60262816 CCTCGCCCAGGCTGGAGTGCTCA No data
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127573044 Original CRISPR TGAGCACTCCAGCCTGGGCG AGG (reversed) Intergenic
No off target data available for this crispr