ID: 1127573045

View in Genome Browser
Species Human (GRCh38)
Location 15:60262799-60262821
Sequence TACAGTGAGCACTCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 5, 1: 41, 2: 54, 3: 89, 4: 700}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127573045_1127573047 -2 Left 1127573045 15:60262799-60262821 CCCAGGCTGGAGTGCTCACTGTA 0: 5
1: 41
2: 54
3: 89
4: 700
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127573045 Original CRISPR TACAGTGAGCACTCCAGCCT GGG (reversed) Intergenic
900969923 1:5986215-5986237 CACAGAGAGCGCGCCAGCCTTGG - Exonic
901108675 1:6777983-6778005 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
901300610 1:8197672-8197694 TGAGTTGAGCACTCCAGCCTGGG + Intergenic
901328778 1:8388353-8388375 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
901484655 1:9550184-9550206 TAGAGACAGGACTCCAGCCTGGG + Intronic
902296208 1:15468748-15468770 TGCAGTGAGCACTTAAGCCTGGG + Intronic
902509514 1:16958595-16958617 GACAGTGAGAACACCAGACTGGG + Exonic
902521259 1:17018171-17018193 TGCAGTGAGCATGCCAGCCAAGG + Intergenic
902597172 1:17517370-17517392 ACCACTGCGCACTCCAGCCTGGG - Intergenic
902598685 1:17526271-17526293 TACAGAGATCACTCCAGTCTTGG - Intergenic
902682578 1:18054036-18054058 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
903148988 1:21391875-21391897 AGCAGAGTGCACTCCAGCCTGGG - Intergenic
903533811 1:24053189-24053211 TGCACTCTGCACTCCAGCCTGGG - Intergenic
903902205 1:26655749-26655771 ACCACTGACCACTCCAGCCTGGG + Intergenic
903948377 1:26978833-26978855 GAGATTGTGCACTCCAGCCTGGG + Intergenic
903987564 1:27239766-27239788 GATCGTGTGCACTCCAGCCTGGG + Intronic
903987576 1:27239933-27239955 GATCGTGTGCACTCCAGCCTGGG - Intronic
904161975 1:28528896-28528918 TGCACTCAGCACTCCAGCCTGGG - Intronic
904444477 1:30557074-30557096 AAGATTGTGCACTCCAGCCTGGG + Intergenic
904581419 1:31546919-31546941 TACAGTCTCCATTCCAGCCTTGG - Intergenic
905077306 1:35284010-35284032 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
905116123 1:35642169-35642191 TGCGGTGAGCACTCCAGCCTGGG + Intergenic
905215341 1:36402391-36402413 TGCACAGTGCACTCCAGCCTGGG + Intergenic
905717995 1:40169578-40169600 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
905868357 1:41388579-41388601 GACAGTGAGAACCCCAGTCTGGG + Intergenic
906178486 1:43797156-43797178 TGCACTCTGCACTCCAGCCTAGG + Intronic
906368419 1:45231277-45231299 TGCACTCTGCACTCCAGCCTGGG + Intronic
906474588 1:46160235-46160257 GACAGTGAGTACTCCATCCTTGG + Intronic
906804157 1:48763888-48763910 AACAGTGAGCTCTCCAGGATGGG - Intronic
908044173 1:60150582-60150604 AGCACTGAGCACTCGAGCCTGGG - Intergenic
908136083 1:61134064-61134086 TACAGTGAGCACTCCAGCCTGGG + Intronic
908950942 1:69561892-69561914 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
909426388 1:75530089-75530111 TACCTTTTGCACTCCAGCCTGGG - Intronic
909457433 1:75866212-75866234 AGCAGTGATCACACCAGCCTGGG - Intronic
910141131 1:84028623-84028645 GAGATTGTGCACTCCAGCCTGGG + Intergenic
910582081 1:88839740-88839762 TGCTGTTGGCACTCCAGCCTGGG + Intergenic
911647946 1:100355621-100355643 TACGATGAGGACTTCAGCCTGGG + Intronic
911948667 1:104143785-104143807 TACTGCATGCACTCCAGCCTGGG - Intergenic
912323021 1:108732297-108732319 TGCAGTGAGCCGACCAGCCTGGG + Intronic
912874127 1:113339371-113339393 AAAAGTGTGCACTCCAGCCTGGG + Intergenic
913032774 1:114927859-114927881 TCCACTGCACACTCCAGCCTTGG - Intronic
913211221 1:116584151-116584173 TGCACTCTGCACTCCAGCCTGGG + Intronic
914439289 1:147689492-147689514 TAGGATAAGCACTCCAGCCTGGG + Intergenic
914816394 1:151066195-151066217 TGCAGTGAGCCTTCCAACCTGGG - Intronic
914888918 1:151605743-151605765 TAAACTGTGCACTCCAGCCTGGG + Intergenic
915124274 1:153652409-153652431 TACACGCTGCACTCCAGCCTGGG + Intergenic
915139784 1:153760188-153760210 TACCATTTGCACTCCAGCCTGGG + Intronic
916139929 1:161687422-161687444 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
916604221 1:166325318-166325340 GCCACTGTGCACTCCAGCCTGGG - Intergenic
916699817 1:167280143-167280165 GAGATTGTGCACTCCAGCCTGGG + Intronic
916738148 1:167626858-167626880 TGCAGTGAGCACTCTATCCTTGG - Intergenic
917233957 1:172870383-172870405 TACAGTCTGCATTCCATCCTGGG - Intergenic
918986522 1:191635064-191635086 TGCAGTGAGCCATGCAGCCTGGG - Intergenic
919028191 1:192203784-192203806 TTCAGTGAGCCTTCCATCCTTGG - Intergenic
919625922 1:199910102-199910124 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
919687953 1:200501973-200501995 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
919998537 1:202776595-202776617 TGCACTCTGCACTCCAGCCTGGG - Intronic
920188904 1:204179775-204179797 TCCCCTGACCACTCCAGCCTTGG - Intergenic
920389962 1:205593409-205593431 TGCAGTGAGCACTCCAGCCTGGG + Intronic
920658262 1:207892541-207892563 TACACTCTGCACTCCGGCCTGGG + Intronic
920928661 1:210366578-210366600 TGCACTCTGCACTCCAGCCTGGG + Intronic
921059070 1:211567113-211567135 ACCAGTGTGCACTCCTGCCTGGG + Intergenic
921209025 1:212876410-212876432 GATTGTGTGCACTCCAGCCTGGG - Intronic
921504505 1:215951898-215951920 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
921643201 1:217580971-217580993 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
923019083 1:230148931-230148953 AGCTGTGATCACTCCAGCCTGGG - Intronic
923215626 1:231845602-231845624 AACAGCGAGCACGCCAGGCTGGG + Intronic
923590231 1:235311307-235311329 TGTACTGTGCACTCCAGCCTGGG + Intronic
923615922 1:235537235-235537257 TAGTGTGCACACTCCAGCCTGGG + Intergenic
923615930 1:235537364-235537386 CATAGTGTGCACTCCAGCCTGGG - Intergenic
923711353 1:236389972-236389994 TACACTTTGCACTCCAGCCTCGG + Intronic
1063831276 10:9956593-9956615 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1064022731 10:11823012-11823034 TACAACGTGCACTCCAGCCTGGG + Intergenic
1064061028 10:12137361-12137383 TGAAGTGATCACTGCAGCCTGGG - Intronic
1064380844 10:14839526-14839548 TGCAGTCTGCACTCCAGCCTGGG + Intronic
1065362598 10:24903161-24903183 GATCGTGAGCGCTCCAGCCTGGG + Intronic
1065429498 10:25639098-25639120 GAGATCGAGCACTCCAGCCTGGG - Intergenic
1065430180 10:25646029-25646051 TGCAGTGAGCTATCCAGCCTCGG - Intergenic
1065590228 10:27256245-27256267 CAGAGATAGCACTCCAGCCTAGG + Intergenic
1065660598 10:28000954-28000976 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1065880926 10:30037031-30037053 TTCAGTGAGACCTACAGCCTTGG - Intronic
1065884778 10:30067360-30067382 TGCACTCTGCACTCCAGCCTGGG - Intronic
1065960907 10:30733440-30733462 TGCAGTGAACACTCTATCCTGGG - Intergenic
1066619075 10:37325037-37325059 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1066631686 10:37464683-37464705 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1066752257 10:38670228-38670250 TGTAGTGAGCTATCCAGCCTGGG - Intergenic
1066964772 10:42252822-42252844 TGTAGTGAGCTATCCAGCCTGGG + Intergenic
1067030256 10:42875063-42875085 TACTGTGGCCCCTCCAGCCTGGG - Intergenic
1067122797 10:43489055-43489077 AACAGTGATCACGCCAGCCCAGG + Intergenic
1067288179 10:44922509-44922531 TCCAGTTAGCACACCAGGCTAGG + Intronic
1067391856 10:45870794-45870816 TGCTGGGTGCACTCCAGCCTGGG - Intergenic
1067871439 10:49965359-49965381 TGCTGGGTGCACTCCAGCCTGGG + Intronic
1068307860 10:55238188-55238210 GCCACTGTGCACTCCAGCCTGGG - Intronic
1068458532 10:57293765-57293787 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1068743105 10:60497243-60497265 TGCAGTGAACACTTCAGCCTAGG + Intronic
1068950788 10:62774996-62775018 GCCACTGCGCACTCCAGCCTGGG + Intergenic
1069413813 10:68180219-68180241 TGCATTCTGCACTCCAGCCTGGG - Intronic
1069557317 10:69406835-69406857 GACAGTGAGAGCTACAGCCTGGG + Intronic
1069594469 10:69661852-69661874 AACAATGAGCTCTCCAGGCTGGG + Intergenic
1069774138 10:70917077-70917099 TACAGTGAGAACTTGAGGCTAGG - Intergenic
1069970180 10:72161155-72161177 TAATGTTTGCACTCCAGCCTGGG + Intronic
1070058615 10:72958956-72958978 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
1070244147 10:74714213-74714235 TGCAGTGAGCACTCCTGCCTGGG + Intergenic
1071176772 10:82935657-82935679 TGCACTCTGCACTCCAGCCTGGG - Intronic
1071450650 10:85789373-85789395 ACCTGTGAGCACTCCAGACTGGG + Intronic
1071595973 10:86925761-86925783 TGCAGTCCGCAGTCCAGCCTGGG - Exonic
1071672665 10:87623971-87623993 TGAGTTGAGCACTCCAGCCTGGG + Intergenic
1071851087 10:89571274-89571296 CACACTGCACACTCCAGCCTGGG - Intergenic
1072395988 10:95041743-95041765 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1072729060 10:97832574-97832596 TATGATGTGCACTCCAGCCTGGG + Intergenic
1073344008 10:102768419-102768441 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1073406144 10:103299821-103299843 TGCACTGCACACTCCAGCCTGGG - Intergenic
1074564864 10:114568152-114568174 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1074582894 10:114737262-114737284 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1074737221 10:116447916-116447938 AACAGACTGCACTCCAGCCTGGG + Intronic
1074792553 10:116905164-116905186 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1076791191 10:132777678-132777700 TACAGTGAGGACGCCCGCCAGGG + Exonic
1078175932 11:8970448-8970470 TGCAGTGAGCTCTCCAGCCTAGG + Intergenic
1078182704 11:9026092-9026114 TACAGTGAACGGTACAGCCTGGG - Intronic
1078521156 11:12064847-12064869 GCCACTGTGCACTCCAGCCTTGG - Intergenic
1078641821 11:13103915-13103937 GAGAGAGAGTACTCCAGCCTGGG + Intergenic
1079073359 11:17367505-17367527 CAGAGTCAGCAGTCCAGCCTAGG + Intronic
1079379780 11:19927520-19927542 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1079651293 11:22933498-22933520 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1079720285 11:23803173-23803195 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1080510346 11:32963705-32963727 TACACCATGCACTCCAGCCTGGG - Intronic
1081578007 11:44331779-44331801 TTCAGTGAGCACTCTAGCCTGGG - Intergenic
1081676201 11:44971221-44971243 TACAGTGAGGGCTCCATCTTGGG - Intergenic
1081765492 11:45607248-45607270 GCCACTGCGCACTCCAGCCTGGG - Intergenic
1081819807 11:45981348-45981370 TGCACTCTGCACTCCAGCCTGGG + Intronic
1082048089 11:47747246-47747268 CACACTTTGCACTCCAGCCTGGG - Intronic
1082980209 11:59114205-59114227 TACAGTGATCACTCAGGCCCTGG - Intronic
1083035329 11:59631577-59631599 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1083190798 11:61050735-61050757 TACACCCTGCACTCCAGCCTGGG + Intergenic
1083859872 11:65414382-65414404 ACCACTGTGCACTCCAGCCTGGG + Intergenic
1083987238 11:66223431-66223453 TACACACTGCACTCCAGCCTGGG - Intronic
1084032446 11:66488892-66488914 TAGCCTGGGCACTCCAGCCTGGG - Intronic
1084078314 11:66799674-66799696 TGCACTCTGCACTCCAGCCTGGG + Intronic
1084427180 11:69090895-69090917 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1085210138 11:74768985-74769007 TGCAGTGAGTGCTCTAGCCTGGG + Intronic
1085317101 11:75552047-75552069 TGCAGTGTGCATTCCAGCCTGGG + Intergenic
1085567517 11:77527886-77527908 TACTGCATGCACTCCAGCCTGGG - Intronic
1085642515 11:78201292-78201314 GACTGTGAGCACTCCAGACCAGG + Intronic
1085668496 11:78439016-78439038 TACAGACTGCACCCCAGCCTGGG - Intronic
1086286172 11:85253878-85253900 TTCAGAGAGGAGTCCAGCCTTGG - Intronic
1086786701 11:90977697-90977719 TGCAGTCAGCAGTCCGGCCTGGG + Intergenic
1087059927 11:93967327-93967349 TACCATTTGCACTCCAGCCTGGG + Intergenic
1087355996 11:97095332-97095354 TGCAGGGAGCACTCCATCCTGGG - Intergenic
1087395053 11:97586441-97586463 TTGCCTGAGCACTCCAGCCTGGG + Intergenic
1087473486 11:98606274-98606296 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1088079568 11:105894833-105894855 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1088261363 11:107946976-107946998 TGCTGTGTGCACTCCGGCCTGGG + Intronic
1088409081 11:109513562-109513584 AGCCGTGAGCACTTCAGCCTGGG + Intergenic
1088442613 11:109888427-109888449 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1089064025 11:115648740-115648762 TAGAGTCAGAACTCCAACCTGGG + Intergenic
1089168860 11:116498857-116498879 TACAGCCAGGACTGCAGCCTGGG + Intergenic
1089343610 11:117776349-117776371 AACAGTGAGCACTGCCTCCTTGG - Intronic
1089486889 11:118853542-118853564 TGCTGTGAACACTCCAGCCTGGG - Intergenic
1089518034 11:119045995-119046017 TGCACTCTGCACTCCAGCCTGGG - Intronic
1089579633 11:119473396-119473418 TTCAGCCTGCACTCCAGCCTGGG + Intergenic
1090097731 11:123759981-123760003 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1090380130 11:126320734-126320756 TAGAGGCTGCACTCCAGCCTGGG + Intronic
1090748609 11:129727044-129727066 TAAAGTGTGGACTCCAGCCCAGG + Intergenic
1090930630 11:131295293-131295315 TGCACTCCGCACTCCAGCCTGGG - Intergenic
1091404592 12:201367-201389 TGATGTGAGCACTCCCGCCTTGG + Intronic
1091438807 12:496554-496576 TGCACTCTGCACTCCAGCCTGGG + Intronic
1091828198 12:3531058-3531080 TCCTCTGAGGACTCCAGCCTGGG + Intronic
1092141530 12:6187027-6187049 GTCACTGTGCACTCCAGCCTGGG + Intergenic
1092360820 12:7834670-7834692 TGCAGTGAGCTATGCAGCCTGGG + Intronic
1092795946 12:12110471-12110493 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1092835159 12:12480765-12480787 GACATCGTGCACTCCAGCCTGGG - Intronic
1093745766 12:22739586-22739608 TGCCGTTTGCACTCCAGCCTGGG + Intergenic
1093807906 12:23457447-23457469 GATGGTGTGCACTCCAGCCTGGG - Intergenic
1093963628 12:25302540-25302562 GAAAGTGAGCCCTACAGCCTGGG - Intergenic
1094006933 12:25763914-25763936 TACACACTGCACTCCAGCCTGGG - Intergenic
1094522036 12:31201832-31201854 GCCACTGGGCACTCCAGCCTGGG - Intergenic
1094590082 12:31811805-31811827 TAGAGTACGCACTCCAGCCTGGG - Intergenic
1094617055 12:32045511-32045533 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1096598116 12:52710188-52710210 TGCAGTGAGCATTTCAGCCTGGG - Intergenic
1097114852 12:56689520-56689542 TGCAGTGAGCACTCCAACTTGGG + Intergenic
1097119809 12:56722647-56722669 TACTGCATGCACTCCAGCCTGGG + Intronic
1097975414 12:65680794-65680816 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1098050145 12:66444448-66444470 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1098817898 12:75191584-75191606 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1099238028 12:80105058-80105080 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1100076939 12:90796876-90796898 TGCAGTGAGCACTTCAGCCTGGG - Intergenic
1100224497 12:92542625-92542647 TGCAGTGAGCACACTAGCCTGGG - Intergenic
1100928779 12:99581853-99581875 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1101009947 12:100438986-100439008 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1101151233 12:101884325-101884347 TGCAGTGATCACTCCAGCTTGGG + Intronic
1101169992 12:102081751-102081773 TGCAGTGAGCCCTTCAGCCTGGG - Intronic
1101390711 12:104297407-104297429 CACACAGTGCACTCCAGCCTGGG - Intronic
1101896625 12:108761935-108761957 GACACTGAGCACTCCAGACAAGG + Intergenic
1101984054 12:109431875-109431897 TTCAGGGAGCACTCCAGCCTGGG - Intronic
1102373705 12:112403933-112403955 TAATGTGTGCACTCCAGCCTGGG - Intergenic
1102668365 12:114596234-114596256 AGCAGTGAGCACTCTAGCCTGGG + Intergenic
1103268800 12:119655085-119655107 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1103361060 12:120354023-120354045 ACCACTGTGCACTCCAGCCTGGG - Intronic
1103429461 12:120870394-120870416 GAGATTGAGCACTCCAGCCTGGG + Intronic
1103480046 12:121244973-121244995 GACAGTCAGCACCCCAACCTGGG - Intronic
1104040420 12:125126620-125126642 GTCAGTGTGCACTCCAGGCTGGG - Intronic
1104076150 12:125391805-125391827 GTCACTGTGCACTCCAGCCTGGG - Intronic
1104239127 12:126970014-126970036 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1104251980 12:127103840-127103862 TGCAGTGAGCACTCCAGTCTAGG + Intergenic
1105763831 13:23538053-23538075 CACCATGCGCACTCCAGCCTGGG + Intergenic
1106329727 13:28729129-28729151 TCCAGGGAGGACTCCATCCTAGG - Intergenic
1106444931 13:29820215-29820237 GCCACTGAGCTCTCCAGCCTGGG - Intronic
1107671646 13:42752531-42752553 TGCTGTGAGCACTCCAGCCTGGG + Intergenic
1107724715 13:43287046-43287068 TAGAGTCAGAACTGCAGCCTAGG - Intronic
1107926985 13:45272781-45272803 AGCTTTGAGCACTCCAGCCTGGG - Intronic
1108143930 13:47456540-47456562 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1108365060 13:49702902-49702924 TGCACTCTGCACTCCAGCCTGGG - Intronic
1109194321 13:59361548-59361570 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
1109468634 13:62774119-62774141 TATAGTGAATATTCCAGCCTGGG - Intergenic
1110125144 13:71932838-71932860 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1110237080 13:73228135-73228157 AACAGTGAAGACTCCAGCCTAGG + Intergenic
1110279796 13:73680004-73680026 TAATCTCAGCACTCCAGCCTGGG - Intergenic
1110286099 13:73752040-73752062 TGCAGTGAGCACTCCAGCCTGGG - Intronic
1110773051 13:79372236-79372258 GCCAGTGCACACTCCAGCCTGGG + Intronic
1111244437 13:85517434-85517456 TGCACACAGCACTCCAGCCTGGG - Intergenic
1112480174 13:99768234-99768256 CACCGTTTGCACTCCAGCCTGGG - Intronic
1112517782 13:100070378-100070400 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1114178832 14:20347913-20347935 TACAAACTGCACTCCAGCCTGGG - Intronic
1114442365 14:22760076-22760098 TACAGTGAGCACTCCAGCCTGGG - Intergenic
1114475430 14:22991210-22991232 TAATGAGTGCACTCCAGCCTGGG - Intronic
1114554561 14:23554415-23554437 TACTGCCTGCACTCCAGCCTCGG - Intronic
1114885915 14:26850618-26850640 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1115121802 14:29945965-29945987 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1115476673 14:33821092-33821114 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1115582484 14:34775154-34775176 TGCAGTGAGCCCAACAGCCTGGG + Intronic
1115981660 14:39058341-39058363 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1116102319 14:40455668-40455690 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1116788223 14:49311232-49311254 TCAAGTGGGCAGTCCAGCCTTGG + Intergenic
1116872607 14:50082620-50082642 TGCAGTGTGCACTCCAGCCTGGG - Intergenic
1116932029 14:50700564-50700586 TGCTGTTTGCACTCCAGCCTGGG - Intergenic
1117144810 14:52826941-52826963 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1119011544 14:70995806-70995828 AGCACTGAGCACTGCAGCCTGGG - Exonic
1119122879 14:72096236-72096258 TGCACTCTGCACTCCAGCCTGGG + Intronic
1119328934 14:73779611-73779633 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1119456365 14:74759258-74759280 CAATGTGATCACTCCAGCCTGGG + Intergenic
1119602791 14:75988317-75988339 TGCGGTGAGCACTCCAGCCTGGG + Intronic
1119896568 14:78224800-78224822 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1120469851 14:84909046-84909068 GACAGTGCAGACTCCAGCCTCGG - Intergenic
1120728837 14:87979082-87979104 TTCAGTGAGCACTCCAGCCTGGG - Intronic
1120790577 14:88577608-88577630 ACCACTGTGCACTCCAGCCTGGG - Intronic
1121191025 14:92030159-92030181 TGCACTCTGCACTCCAGCCTGGG + Intronic
1121746828 14:96302531-96302553 TACAATCTGCACTCCAGCCTGGG + Intronic
1123101395 14:105804128-105804150 CACTGTGTGCATTCCAGCCTAGG - Intergenic
1123710950 15:22987291-22987313 TCCATTGTGCACTCCAGCCTGGG + Intronic
1123936781 15:25197904-25197926 TTCAGTGAGCTCTTCAGCCCAGG + Intergenic
1124128994 15:26968344-26968366 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1124422518 15:29535206-29535228 TGCCGTTTGCACTCCAGCCTGGG + Intronic
1124911598 15:33926701-33926723 GAGATTGTGCACTCCAGCCTGGG - Intronic
1124928592 15:34096925-34096947 TGCAGTGAGCTGTCCAGCCTGGG + Intronic
1125489600 15:40136764-40136786 TTCAGAGAGCTGTCCAGCCTGGG + Intergenic
1125631855 15:41153812-41153834 TCCAGACTGCACTCCAGCCTGGG - Intergenic
1125930790 15:43598644-43598666 AGCTGTGATCACTCCAGCCTGGG + Intronic
1125943956 15:43698465-43698487 AGCTGTGATCACTCCAGCCTGGG + Intronic
1125974307 15:43937600-43937622 TGCACTCTGCACTCCAGCCTGGG + Intronic
1125980851 15:44000048-44000070 TGCAATGAGCACTCCAGCCAGGG - Intronic
1126666476 15:51079811-51079833 TGCACTCTGCACTCCAGCCTGGG + Intronic
1127028392 15:54833842-54833864 TACAGGGGACACTCCAGCCAAGG - Intergenic
1127336430 15:57989955-57989977 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1127500924 15:59553570-59553592 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1127503261 15:59574589-59574611 TGAGCTGAGCACTCCAGCCTGGG - Intergenic
1127573045 15:60262799-60262821 TACAGTGAGCACTCCAGCCTGGG - Intergenic
1127623619 15:60758521-60758543 AACAGAGAGGTCTCCAGCCTTGG - Intronic
1128103368 15:65024556-65024578 TGCAGTGAGCCATCCAGCCTGGG - Intronic
1128122082 15:65158074-65158096 CACAGGCTGCACTCCAGCCTGGG - Intronic
1128193416 15:65726913-65726935 ACCACTGCGCACTCCAGCCTGGG + Intronic
1128205078 15:65843817-65843839 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1128961439 15:72009653-72009675 TGCAGTGAGCACTCCAGTCTGGG + Intronic
1129395595 15:75243745-75243767 TGCAGTGAGCACTTCAGCCTGGG + Intergenic
1129689813 15:77706758-77706780 TACAGTGAGCAAGGCAGCCATGG - Intronic
1129720329 15:77874538-77874560 TACACTCCACACTCCAGCCTGGG - Intergenic
1130642201 15:85687985-85688007 CGCTGTGTGCACTCCAGCCTGGG + Intronic
1130905601 15:88238883-88238905 AACAGTGAGGATTCCAGCCCAGG - Intronic
1130939598 15:88496736-88496758 TACAGTGAGAACACCATGCTTGG + Intergenic
1131045853 15:89314883-89314905 TTGAATGTGCACTCCAGCCTGGG - Intronic
1131135875 15:89935012-89935034 TACACACTGCACTCCAGCCTGGG - Intergenic
1131161729 15:90109785-90109807 TACACACTGCACTCCAGCCTGGG - Intergenic
1131766002 15:95676668-95676690 AGCAGTGAACACTCCAGCGTGGG - Intergenic
1131822195 15:96284660-96284682 CTCAGTGATGACTCCAGCCTTGG + Intergenic
1131968737 15:97871710-97871732 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1132819357 16:1855394-1855416 TGCACTCTGCACTCCAGCCTGGG + Intronic
1133055873 16:3145276-3145298 CACAGTGAGACCTTCAGCCTTGG - Intronic
1133102659 16:3488570-3488592 TTCTGTTTGCACTCCAGCCTGGG + Intergenic
1133216232 16:4294151-4294173 TACAGCTGGCCCTCCAGCCTCGG + Intergenic
1133282436 16:4674674-4674696 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1133949767 16:10381200-10381222 TCCAGGCTGCACTCCAGCCTGGG - Intronic
1133963134 16:10511646-10511668 TGCAGTGAGCACTCCAGCCTAGG + Intergenic
1134180036 16:12040316-12040338 TGCAGTGAGCTGTCCAGCCTGGG + Intronic
1134796175 16:17039091-17039113 TATGATCAGCACTCCAGCCTGGG - Intergenic
1135104325 16:19634375-19634397 TGCAGTGAGCCCTCCAGCCCGGG + Intronic
1135293496 16:21260346-21260368 GACATCGTGCACTCCAGCCTGGG - Intronic
1135581147 16:23627449-23627471 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1135916571 16:26610430-26610452 TACAGGTGGCACTCCATCCTGGG + Intergenic
1136353605 16:29728911-29728933 TGCAGGTGGCACTCCAGCCTGGG - Intergenic
1136526087 16:30831717-30831739 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1136645079 16:31606966-31606988 TGCAGTGAGCACTCCAGCCTTGG + Intergenic
1136660158 16:31750817-31750839 TGCAGTGAGCACTCCAGCCTGGG - Intronic
1136730468 16:32406811-32406833 TGTAGTGAGCTATCCAGCCTGGG + Intergenic
1136926923 16:34382717-34382739 TACATAAATCACTCCAGCCTGGG - Intergenic
1136977651 16:35029090-35029112 TACATAAATCACTCCAGCCTGGG + Intergenic
1137039898 16:35600841-35600863 AGAAGTGGGCACTCCAGCCTGGG + Intergenic
1137608986 16:49806299-49806321 GACAGTGGGCACATCAGCCTGGG + Intronic
1137613062 16:49831939-49831961 TGCAGTAAGCACTCCAGCCTGGG + Intronic
1138034700 16:53592560-53592582 TGCACTCCGCACTCCAGCCTGGG + Intergenic
1138145642 16:54608163-54608185 TACAGTGAGCACTTTAGCCTGGG + Intergenic
1138539962 16:57682178-57682200 AGCAGAGAGCACTGCAGCCTGGG + Intronic
1138682734 16:58697782-58697804 TACTGCAATCACTCCAGCCTGGG + Intergenic
1139502603 16:67379660-67379682 TGAGCTGAGCACTCCAGCCTAGG + Intronic
1139739214 16:69020842-69020864 AGCTGTGATCACTCCAGCCTGGG + Intronic
1139900824 16:70327173-70327195 TGGAGTCAGAACTCCAGCCTAGG - Intronic
1140147319 16:72323801-72323823 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1140319368 16:73933871-73933893 TGCAGTGTGCACTCCAGCCTGGG - Intergenic
1140350266 16:74255775-74255797 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1141542293 16:84735068-84735090 TGCACTCTGCACTCCAGCCTGGG - Intronic
1141626416 16:85263968-85263990 AACAGCGGGCCCTCCAGCCTGGG + Intergenic
1141845586 16:86606304-86606326 GAGTGTGAGCACTCAAGCCTTGG + Intergenic
1141868140 16:86765220-86765242 ACCACTGTGCACTCCAGCCTGGG - Intergenic
1141906912 16:87033034-87033056 TGGAGTGAGCAATCCAGCCCCGG + Intergenic
1141916012 16:87097660-87097682 TAAAGTGAACAATTCAGCCTGGG + Intronic
1202995939 16_KI270728v1_random:110501-110523 TGTAGTGAGCTATCCAGCCTGGG - Intergenic
1203022626 16_KI270728v1_random:422843-422865 TGTAGTGAGCTATCCAGCCTGGG - Intergenic
1142653435 17:1372891-1372913 TGCAGTGAGCATTCCTGCCTGGG + Intronic
1142842124 17:2641190-2641212 CACTCTGTGCACTCCAGCCTGGG - Intronic
1144222163 17:13109738-13109760 TACAGTGAGCACTCCAGCCTGGG - Intergenic
1144347241 17:14360336-14360358 TGCGATGAGCACTCCAGCCTGGG - Intergenic
1144442842 17:15299546-15299568 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1145034235 17:19529057-19529079 TGCACTCTGCACTCCAGCCTGGG + Intronic
1146382911 17:32344546-32344568 GGCAGAGTGCACTCCAGCCTGGG + Intronic
1146384491 17:32357693-32357715 TGCAGTGAGCACTCCAGCCTGGG - Intronic
1146965829 17:37029116-37029138 TGCAGTGAGCCCTCCGGTCTGGG - Intronic
1147006844 17:37410147-37410169 TGCAATGAGTACTCCAGCCTGGG + Intronic
1147177614 17:38666002-38666024 AAGATTGTGCACTCCAGCCTGGG + Intergenic
1147179976 17:38678196-38678218 GAGATTGAGCACTCCAGCCTGGG - Intergenic
1147629629 17:41921433-41921455 GAGATTGTGCACTCCAGCCTGGG + Intronic
1147655106 17:42085315-42085337 GACATTGTGCACTCCAGCCTGGG - Intergenic
1147900631 17:43781377-43781399 GAGATTGTGCACTCCAGCCTAGG - Intronic
1147990430 17:44329269-44329291 TGCAGTCTGCAGTCCAGCCTGGG - Intergenic
1148382100 17:47207298-47207320 TACAGAGAGCACTGCACCCCAGG + Intronic
1148399956 17:47349808-47349830 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1148521520 17:48280442-48280464 GACAGGCTGCACTCCAGCCTGGG + Intronic
1149798700 17:59545906-59545928 TCCAGCCTGCACTCCAGCCTGGG + Intergenic
1149822296 17:59791532-59791554 AGGAGTGAGCACTCCAGCTTGGG - Intronic
1150107308 17:62471939-62471961 TGCACTCTGCACTCCAGCCTAGG - Intronic
1150177447 17:63075566-63075588 TGCACTCTGCACTCCAGCCTAGG - Intronic
1150685689 17:67319136-67319158 AGCAATGAGCTCTCCAGCCTGGG + Intergenic
1150687963 17:67335926-67335948 TGCAGTAAGCACTCCAGCCTGGG + Intergenic
1150877498 17:68985895-68985917 TGCACTGAGCACTCCAGCCTGGG + Intronic
1151078664 17:71303414-71303436 TTCAGAGAGCATTCCAGCCCTGG + Intergenic
1152763673 17:82123169-82123191 TACACACTGCACTCCAGCCTGGG - Intronic
1153561100 18:6372329-6372351 TACAGCAAGCACACCAGCATCGG - Intronic
1153948279 18:10035886-10035908 TTCAGTGAGCACTCCAGATATGG + Intergenic
1154159858 18:11972924-11972946 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1154214427 18:12405608-12405630 TGTAGTGAGCACTCCAGCTTGGG + Intergenic
1154342495 18:13515846-13515868 TCCAGGTTGCACTCCAGCCTGGG - Intronic
1155005008 18:21720917-21720939 TGCACTCTGCACTCCAGCCTGGG + Intronic
1155656038 18:28194398-28194420 TGCACTCCGCACTCCAGCCTGGG + Intergenic
1155871725 18:31037853-31037875 TCCAGCCTGCACTCCAGCCTGGG + Intronic
1156097683 18:33555299-33555321 TCCATCCAGCACTCCAGCCTGGG - Intergenic
1156192095 18:34731441-34731463 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1156861283 18:41839019-41839041 TACTGCATGCACTCCAGCCTGGG + Intergenic
1157088604 18:44608420-44608442 GACAGAGTGCACTCCAGCTTAGG - Intergenic
1157197840 18:45634103-45634125 AACACTGAGCACCCCACCCTGGG + Intronic
1157825588 18:50809100-50809122 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1158269342 18:55696002-55696024 TACAATCTGCACTCCAGCCCAGG - Intergenic
1158723145 18:59943884-59943906 TACCATTTGCACTCCAGCCTGGG - Intergenic
1159215836 18:65389110-65389132 TGCAGTGAGCACTCCAGCCTTGG + Intergenic
1159234512 18:65653506-65653528 ATCACTGAGCACTCCAGCCTGGG + Intergenic
1160186911 18:76682877-76682899 TAGACAGGGCACTCCAGCCTGGG - Intergenic
1160502252 18:79407486-79407508 TCCAGCCTGCACTCCAGCCTGGG - Intronic
1161005963 19:1936845-1936867 GATGGCGAGCACTCCAGCCTGGG + Intergenic
1161094545 19:2382202-2382224 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
1161136996 19:2625836-2625858 ATCAGTGAGCAGTCCAGCCTGGG - Intronic
1161327465 19:3670651-3670673 TCCAGTGAGGACCCCAGCCCTGG + Intronic
1161424303 19:4194203-4194225 ACCTGAGAGCACTCCAGCCTGGG - Intronic
1161608318 19:5227088-5227110 TACACCCTGCACTCCAGCCTGGG - Intronic
1162082300 19:8225462-8225484 TCCATTGCGCACTCCAGCCTGGG - Intronic
1162380925 19:10331312-10331334 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1162663922 19:12193921-12193943 TGCATTCTGCACTCCAGCCTGGG + Intergenic
1162684384 19:12369556-12369578 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1162703448 19:12537216-12537238 TACAGTCAGCCCTCCATACTTGG + Intronic
1162741807 19:12777870-12777892 TACAGTAAGCACTCCATACATGG - Intronic
1162777148 19:12986703-12986725 TGCAGTGAGCATTCCAGCCTGGG - Intergenic
1162937767 19:13990096-13990118 CACACTGAGGTCTCCAGCCTGGG - Intronic
1163096537 19:15062026-15062048 TGCAGTGAGCACTCTAGCCTGGG + Intergenic
1163304162 19:16467187-16467209 TCCACTGCACACTCCAGCCTGGG - Intronic
1163317634 19:16552381-16552403 GAGATTGTGCACTCCAGCCTGGG - Exonic
1163818824 19:19484571-19484593 GCCACTGCGCACTCCAGCCTGGG - Intronic
1164031360 19:21408923-21408945 TCCACTGCACACTCCAGCCTGGG - Intronic
1164189685 19:22902495-22902517 TACAGGGATCGCTTCAGCCTGGG + Intergenic
1164559441 19:29279118-29279140 TGGAGTGAGCACTCCAGCCTGGG - Intergenic
1165189919 19:34054167-34054189 GAGACTGTGCACTCCAGCCTGGG + Intergenic
1165255360 19:34574542-34574564 CCCAGTCTGCACTCCAGCCTGGG + Intergenic
1165398953 19:35585538-35585560 CACACTGCACACTCCAGCCTGGG - Intergenic
1165439558 19:35816983-35817005 GACATTGTGCACTCCAGCCTGGG - Intergenic
1165487834 19:36106040-36106062 TACAGTGGGCAAGCCTGCCTGGG - Intergenic
1165536693 19:36453725-36453747 TACAGTGAGGACTGTGGCCTGGG - Intronic
1165791554 19:38495809-38495831 GACATTGCGCACTCCAGGCTTGG - Intronic
1165873200 19:38987849-38987871 TGCACTGCACACTCCAGCCTGGG - Intergenic
1166113350 19:40637025-40637047 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1166294353 19:41881697-41881719 TGCAGTGAGCACTCCAACCTGGG - Intergenic
1166349277 19:42187420-42187442 GAGATTGTGCACTCCAGCCTAGG + Intronic
1166516188 19:43448771-43448793 CACTGACAGCACTCCAGCCTGGG + Intergenic
1166828859 19:45626432-45626454 TCAAATGATCACTCCAGCCTGGG - Intronic
1166929567 19:46293807-46293829 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1168151800 19:54453047-54453069 CACAGGGAGCACTGCAGCCAGGG - Intronic
1168274147 19:55267190-55267212 TCCACTGCACACTCCAGCCTGGG - Intronic
1168388445 19:55985954-55985976 TGCACTGAGTACTCCAGCCTGGG + Intronic
1168523064 19:57067979-57068001 TAGGGTGAGGACTCCAGGCTGGG + Intergenic
925643961 2:6017097-6017119 TGCAGTCCGCATTCCAGCCTGGG - Intergenic
925792987 2:7511798-7511820 TACAGTGGGCACTCCTACCAGGG - Intergenic
925995602 2:9290248-9290270 GCCACTGTGCACTCCAGCCTGGG - Intronic
926002882 2:9348174-9348196 CACAGTGAGCCATCCAGCCTGGG - Intronic
926169574 2:10543901-10543923 TGCACTCTGCACTCCAGCCTGGG + Intergenic
927160796 2:20258701-20258723 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
927396885 2:22662454-22662476 TACAGTCTGCACTCCAGCCTGGG - Intergenic
927545542 2:23949503-23949525 TAGAGGTTGCACTCCAGCCTGGG + Intronic
927763135 2:25778913-25778935 TACAGTGTGCACACCACACTAGG + Intronic
927795943 2:26048821-26048843 AGCTGTGATCACTCCAGCCTGGG + Intronic
927824232 2:26296619-26296641 TCCAGGCTGCACTCCAGCCTGGG + Intergenic
928012015 2:27617989-27618011 TGCAGTGAGCCCTCCAGATTGGG - Intronic
928313397 2:30229099-30229121 GAAATTGTGCACTCCAGCCTGGG - Intergenic
929224184 2:39496056-39496078 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
929715792 2:44308093-44308115 TCCAGGGTGAACTCCAGCCTGGG + Intronic
929719863 2:44356846-44356868 CACAGTGAGATCTTCAGCCTGGG - Intronic
930806418 2:55495065-55495087 TCCAGCCTGCACTCCAGCCTGGG + Intergenic
930984429 2:57567927-57567949 TCATGTCAGCACTCCAGCCTGGG - Intergenic
931307444 2:61044310-61044332 TGCACTACGCACTCCAGCCTGGG - Intronic
931574567 2:63706650-63706672 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
932278089 2:70466470-70466492 TGCACTCTGCACTCCAGCCTGGG + Intronic
932297380 2:70637875-70637897 TGCACTCTGCACTCCAGCCTGGG + Intronic
932371609 2:71193792-71193814 TGCAGTGAGTACTCCAGCCTGGG + Intronic
932395265 2:71441159-71441181 GAGATTGTGCACTCCAGCCTAGG - Intergenic
933172619 2:79140502-79140524 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
933196480 2:79395843-79395865 CACAGACAGCACTCCAGCCTGGG - Intronic
933562359 2:83903971-83903993 TGCACTCTGCACTCCAGCCTGGG + Intergenic
933732242 2:85465829-85465851 TGCAGTGAGCACTCTAGCCTGGG + Intergenic
933850408 2:86361997-86362019 TAAGGTAAGCACTCCAGCCTGGG - Intergenic
934186775 2:89684859-89684881 TGTAGTGAGCTATCCAGCCTGGG + Intergenic
934264431 2:91502333-91502355 AAAAATAAGCACTCCAGCCTGGG - Intergenic
934315252 2:91912367-91912389 TGTAGTGAGCTATCCAGCCTGGG - Intergenic
934880954 2:97978442-97978464 TGCAGTAAGCACTCCAGCCTGGG - Intronic
935287466 2:101578380-101578402 CACTGTAATCACTCCAGCCTGGG + Intergenic
935665495 2:105508547-105508569 TACGCTACGCACTCCAGCCTGGG - Intergenic
936378068 2:111959531-111959553 TACAGTGAGCACTCCAGGCTGGG - Intronic
936587188 2:113768616-113768638 GAGACTGTGCACTCCAGCCTGGG - Intergenic
937085938 2:119171865-119171887 TACAGTGAGGGCCCCAGCATGGG + Intergenic
937088130 2:119185594-119185616 TGCAGGGAGCACTCCAGCCTGGG + Intergenic
937414574 2:121703990-121704012 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
937549754 2:123072955-123072977 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
937972469 2:127561305-127561327 GAGATTGCGCACTCCAGCCTGGG - Intronic
938031839 2:128001325-128001347 TAAAGTGAGCTCTCCAGCCTGGG + Intronic
938034038 2:128020945-128020967 AAGACTGTGCACTCCAGCCTGGG + Intronic
938410515 2:131060068-131060090 TGGTGTCAGCACTCCAGCCTGGG - Intronic
938770240 2:134495292-134495314 TAAGGTTGGCACTCCAGCCTGGG + Intronic
939968221 2:148631853-148631875 TGAGCTGAGCACTCCAGCCTGGG - Intergenic
940776449 2:157889319-157889341 GCCACTGTGCACTCCAGCCTGGG + Intronic
940781380 2:157937401-157937423 GCCACTGTGCACTCCAGCCTGGG + Intronic
940867990 2:158836214-158836236 AACATTGTGCACTCCAGCCTGGG + Intronic
941356154 2:164494992-164495014 AGCCGAGAGCACTCCAGCCTGGG - Intronic
941816707 2:169803298-169803320 TGCACTCTGCACTCCAGCCTGGG - Intronic
941990378 2:171550152-171550174 GACATTGTGCACTTCAGCCTGGG - Intronic
942175828 2:173333911-173333933 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
942223043 2:173789999-173790021 TCTAGTCTGCACTCCAGCCTGGG - Intergenic
942344924 2:174992842-174992864 TTCGGTGAGCACTCCAGCCTGGG - Intronic
943156450 2:184185693-184185715 TACCGCACGCACTCCAGCCTGGG - Intergenic
943401117 2:187411934-187411956 TGCAGACTGCACTCCAGCCTGGG + Intronic
943435158 2:187856107-187856129 TGCAGTGAGCAGAGCAGCCTGGG + Intergenic
944573235 2:201066118-201066140 GATTGTGTGCACTCCAGCCTGGG - Intronic
945335401 2:208587053-208587075 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
945550018 2:211209940-211209962 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
946251390 2:218415521-218415543 ACCAGTGTGCACTCCAGGCTGGG + Intergenic
946712483 2:222520682-222520704 TGCAGTGTGCATTCCAGCCTGGG + Intronic
946754784 2:222932893-222932915 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
946901303 2:224374387-224374409 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
947510608 2:230750267-230750289 AACAGTGAGAACTCAATCCTGGG - Intronic
947678917 2:232011696-232011718 GAGACTGTGCACTCCAGCCTGGG - Intronic
947769120 2:232656829-232656851 AGCTGTGATCACTCCAGCCTAGG - Intronic
947814679 2:233028509-233028531 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
947836595 2:233180289-233180311 TACAGTGTGCCCTTAAGCCTAGG - Intronic
948109410 2:235442694-235442716 TGCACTTTGCACTCCAGCCTAGG - Intergenic
948678635 2:239614879-239614901 TGCAGTAAGCATTTCAGCCTAGG + Intergenic
948899309 2:240948111-240948133 TGAAGAGAGCACTCAAGCCTGGG + Intronic
949024329 2:241758675-241758697 TCCAGTGATCCTTCCAGCCTTGG - Intronic
1168784322 20:524668-524690 TGCAGTGGGCACTCCAGCATGGG + Intronic
1168985617 20:2046065-2046087 ACCACTGTGCACTCCAGCCTGGG + Intergenic
1169103847 20:2977247-2977269 TCCAGACTGCACTCCAGCCTGGG + Intronic
1169136024 20:3198054-3198076 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1169422509 20:5471558-5471580 GACAGGGAGGAGTCCAGCCTGGG - Intergenic
1169640240 20:7743095-7743117 TAGGGTGAGGACTCCAGCTTAGG + Intergenic
1170198143 20:13712025-13712047 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1170549291 20:17462483-17462505 CACAGTGAGAACTCCTGACTAGG + Intronic
1170855255 20:20047188-20047210 TACAGTTAGTCCTCCAGCCATGG + Intronic
1171142241 20:22753351-22753373 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1171225317 20:23437775-23437797 CACACCAAGCACTCCAGCCTGGG - Intergenic
1171997651 20:31744566-31744588 TGAAGTGCACACTCCAGCCTGGG - Intronic
1172251896 20:33485627-33485649 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1172410644 20:34719717-34719739 TGGAGGGAGCTCTCCAGCCTGGG + Intronic
1172414275 20:34751332-34751354 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1172432623 20:34905301-34905323 TGCACTCTGCACTCCAGCCTGGG - Intronic
1172671380 20:36636383-36636405 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1173255640 20:41392714-41392736 TACGGCAAGCACTCCAGCCTGGG + Intergenic
1173501265 20:43555683-43555705 GAGATTGTGCACTCCAGCCTGGG + Intronic
1173512313 20:43639792-43639814 TACACCTTGCACTCCAGCCTGGG + Intronic
1173693758 20:44988437-44988459 TGCACTCTGCACTCCAGCCTGGG + Intronic
1173706904 20:45116714-45116736 GGCACTGTGCACTCCAGCCTGGG - Intergenic
1174313090 20:49674641-49674663 TACAGAGACCAGACCAGCCTGGG + Intronic
1174509198 20:51038192-51038214 AGCAGCCAGCACTCCAGCCTGGG + Intergenic
1174740180 20:53005267-53005289 CACACCGTGCACTCCAGCCTGGG + Intronic
1175190341 20:57207863-57207885 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1175808501 20:61844926-61844948 TACAGGCAGCACTCCAACTTTGG + Intronic
1175854285 20:62112123-62112145 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1176086865 20:63299949-63299971 TGCACTGTGCACTCCAGCCCGGG - Intronic
1177435662 21:21049052-21049074 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1177774885 21:25556986-25557008 TGCAGTGAGCACTCCAGTCCAGG + Intergenic
1178150054 21:29783971-29783993 GCCACTGAGCACTCCAGCCTGGG - Intronic
1178319619 21:31595528-31595550 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1178414007 21:32389218-32389240 TCCAGTGTACCCTCCAGCCTTGG - Intronic
1178778983 21:35581113-35581135 TGCCCTGAGCCCTCCAGCCTTGG - Intronic
1178783828 21:35633700-35633722 GACAGTGATCAATTCAGCCTCGG - Intronic
1179821207 21:43938365-43938387 TACAGTGAGCACTCCAGCCTGGG - Intronic
1180044486 21:45298358-45298380 AGCAGAGATCACTCCAGCCTGGG - Intergenic
1180542014 22:16458250-16458272 TGTAGTGAGCTATCCAGCCTGGG - Intergenic
1180660539 22:17463154-17463176 TACACTCAGCACTCCCGGCTGGG - Intronic
1180834765 22:18924446-18924468 AGGCGTGAGCACTCCAGCCTGGG + Intronic
1181284195 22:21740221-21740243 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1181494181 22:23278689-23278711 TGCACTCTGCACTCCAGCCTGGG + Intronic
1182185328 22:28395570-28395592 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1182378056 22:29862938-29862960 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
1182769779 22:32786420-32786442 TGCAGTGAGCACTCCAGCCTGGG - Intronic
1183878676 22:40806879-40806901 TACAGACAGTACTCCAGCCTGGG - Intronic
1184238530 22:43199591-43199613 CACCGTGAGCCCTGCAGCCTGGG + Exonic
1184286349 22:43473841-43473863 GACAGTGCACACTCCTGCCTAGG + Intronic
1184392224 22:44210734-44210756 TGCAGTGAGCACTGCAGTCTGGG - Intronic
1184463615 22:44655826-44655848 GCCACTGAACACTCCAGCCTGGG + Intergenic
1184752537 22:46496156-46496178 TGCACTCTGCACTCCAGCCTGGG + Intronic
1184911964 22:47541099-47541121 TGCAGTCCGCAGTCCAGCCTAGG + Intergenic
1185404634 22:50640918-50640940 CACAGTGAGCACTCCAGGCTGGG - Intergenic
1203284854 22_KI270734v1_random:149745-149767 AGGCGTGAGCACTCCAGCCTGGG + Intergenic
949352587 3:3139768-3139790 CACACTGTGCACTCCAGCCTAGG - Intronic
949718676 3:6963563-6963585 TACAGTGAGCCCTCCAGCCTGGG + Intronic
950071354 3:10155314-10155336 TTCAGTTTGCACTCCAGCCTGGG + Intergenic
950296395 3:11836030-11836052 TGCACTCCGCACTCCAGCCTAGG - Intronic
950394133 3:12720769-12720791 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
950494155 3:13323858-13323880 TGCAGGGAGGTCTCCAGCCTGGG - Intronic
950639808 3:14341478-14341500 TACTCTGACCACTGCAGCCTGGG + Intergenic
950642888 3:14359897-14359919 GGAAGTGAGCACCCCAGCCTCGG + Intergenic
951050090 3:18084468-18084490 TGCACTCTGCACTCCAGCCTGGG + Intronic
951102875 3:18709696-18709718 TGCATTCTGCACTCCAGCCTGGG + Intergenic
951654431 3:24989833-24989855 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
952472009 3:33665058-33665080 GACACTGCACACTCCAGCCTGGG + Intronic
952626870 3:35416526-35416548 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
952800465 3:37286187-37286209 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
953311897 3:41888687-41888709 TACAGTGAGCAATCCACCTTGGG + Intronic
953917365 3:46928945-46928967 CACACTCTGCACTCCAGCCTAGG + Intronic
954174879 3:48836376-48836398 GCCATTGTGCACTCCAGCCTGGG + Intronic
954392013 3:50272793-50272815 GAGATCGAGCACTCCAGCCTGGG + Intronic
954874492 3:53792786-53792808 TACAGTGAGGACTGCAGCCAAGG - Intronic
954968050 3:54628181-54628203 GAGATTGTGCACTCCAGCCTGGG + Intronic
955245519 3:57221194-57221216 TACAGGCTGCACTCCAGCATGGG - Intronic
955275699 3:57545201-57545223 TGTGGTGAGCACTCCAGCCTGGG - Intergenic
955314282 3:57922467-57922489 GCCACTGTGCACTCCAGCCTGGG - Intronic
955482126 3:59400525-59400547 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
956094356 3:65700405-65700427 ACCACTGGGCACTCCAGCCTGGG + Intronic
956778213 3:72584157-72584179 ATCTGTGATCACTCCAGCCTGGG - Intergenic
957495998 3:80992151-80992173 TCCACTGCACACTCCAGCCTGGG - Intergenic
957637954 3:82811233-82811255 AGCTGTGATCACTCCAGCCTGGG + Intergenic
957961987 3:87268129-87268151 AGCCGAGAGCACTCCAGCCTAGG - Intronic
958591493 3:96163925-96163947 TACACACTGCACTCCAGCCTGGG + Intergenic
960621369 3:119639683-119639705 CATAATGGGCACTCCAGCCTGGG - Intronic
961215855 3:125159999-125160021 CACAGTGAGCACTCCAGCCTGGG - Intronic
961230832 3:125306822-125306844 TGCACTCTGCACTCCAGCCTGGG + Intronic
961697561 3:128716345-128716367 GAGATTGTGCACTCCAGCCTGGG - Intergenic
961719119 3:128880452-128880474 TGCAGTGAGCACTCCAGCCTGGG - Intronic
961860601 3:129914030-129914052 TGCAGTGTGCACTCCAGTCTGGG + Intergenic
962127748 3:132640154-132640176 TGGAGGTAGCACTCCAGCCTGGG - Intronic
962799940 3:138881775-138881797 TAATGTCAGCTCTCCAGCCTGGG + Intergenic
963029269 3:140951522-140951544 GCCAGTGCACACTCCAGCCTGGG - Intronic
963114482 3:141714687-141714709 GATCGTGTGCACTCCAGCCTGGG + Intergenic
963139341 3:141934762-141934784 TGCAGAGTGCACTCCAGCCTGGG - Intergenic
963413460 3:144962177-144962199 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
963924591 3:150938176-150938198 GACAGTGAGCACTGCCACCTGGG + Intronic
964094961 3:152920374-152920396 TGCACTCTGCACTCCAGCCTGGG + Intergenic
964303900 3:155320257-155320279 ACCACTGTGCACTCCAGCCTGGG - Intergenic
965578879 3:170246166-170246188 AAGAGCGAGCACTACAGCCTGGG - Intronic
965584849 3:170308369-170308391 TGCAGTGAGCCCTCGAGTCTGGG + Intergenic
965983165 3:174718067-174718089 TGCAGTGAGCGCTCCAGCCTGGG + Intronic
966873533 3:184307966-184307988 CACAGTGAGCAGTCCAGCCACGG - Exonic
967029284 3:185590823-185590845 TGCACTCTGCACTCCAGCCTGGG + Intronic
967067423 3:185931355-185931377 AGCAGTGAGCTCTCCAGCATGGG - Intronic
967192847 3:186999887-186999909 TACAATAGCCACTCCAGCCTGGG - Intronic
967533644 3:190577588-190577610 TGCAGTGAGCACTCTAGCCTAGG - Intronic
968727275 4:2253615-2253637 AACACTGAGCACCCCAGCCTTGG + Intronic
969559983 4:7940563-7940585 CACTGCGTGCACTCCAGCCTGGG + Intergenic
970598357 4:17620391-17620413 TGCAGTGAGCACTCCAGCCTGGG - Intronic
970954872 4:21798470-21798492 GAGGCTGAGCACTCCAGCCTGGG + Intronic
971226982 4:24763511-24763533 GAGCTTGAGCACTCCAGCCTGGG - Intergenic
971284615 4:25275614-25275636 TGCACTCTGCACTCCAGCCTGGG + Intronic
971445433 4:26741318-26741340 TACAGTCCGCAGTCCGGCCTGGG + Intronic
971913752 4:32831735-32831757 TATTGTCACCACTCCAGCCTGGG + Intergenic
971968201 4:33590631-33590653 TACAGTTAGCCCTCCACCGTTGG + Intergenic
972433927 4:39013263-39013285 TGCACTCGGCACTCCAGCCTAGG + Intronic
972558238 4:40201993-40202015 TACACACTGCACTCCAGCCTGGG - Intronic
973168294 4:47106285-47106307 CACAGTGAAGACTCCAGGCTTGG + Intronic
973674191 4:53247823-53247845 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
974170129 4:58255831-58255853 TACAGTCAGCATTCTACCCTAGG - Intergenic
974531974 4:63120524-63120546 TGCACTCTGCACTCCAGCCTGGG - Intergenic
974796743 4:66762627-66762649 TGCACTCTGCACTCCAGCCTGGG - Intergenic
975117296 4:70694106-70694128 TGCAGTGAGCACTCAAGCCTGGG + Intergenic
975151012 4:71021109-71021131 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
975303651 4:72821756-72821778 TGCAGTGAGCACTCCATCCTGGG + Intergenic
975687297 4:76929951-76929973 GCCAGTGGGTACTCCAGCCTGGG + Intergenic
976183463 4:82421167-82421189 TCCAGCCTGCACTCCAGCCTGGG + Intergenic
976311957 4:83621495-83621517 GCCAGTGCCCACTCCAGCCTGGG - Intergenic
976488898 4:85643292-85643314 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
976999738 4:91482364-91482386 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
977410036 4:96651208-96651230 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
978778825 4:112528897-112528919 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
979280003 4:118856579-118856601 TGCAGTGAGCACTTCAGCCTGGG - Intronic
979301504 4:119092705-119092727 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
980968295 4:139545223-139545245 TTGCTTGAGCACTCCAGCCTGGG - Intronic
981053236 4:140332412-140332434 TGCACTCTGCACTCCAGCCTGGG - Intronic
981647955 4:147021075-147021097 CGGAGTGTGCACTCCAGCCTCGG - Intergenic
981734632 4:147936362-147936384 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
981841540 4:149118954-149118976 CACTGAAAGCACTCCAGCCTGGG - Intergenic
981882637 4:149633123-149633145 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
982742493 4:159072497-159072519 TACACTCCACACTCCAGCCTGGG - Intergenic
983289127 4:165779348-165779370 TGCAGAGAGCACTCCAGCCTGGG - Intergenic
983823944 4:172233310-172233332 TGCAGTGAGCTATCCAGCCTGGG + Intronic
984012920 4:174392181-174392203 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
984241944 4:177228295-177228317 TGCAGTAAGCACTCCAGCCTGGG + Intergenic
984395198 4:179188891-179188913 TGCAGTCTGCAGTCCAGCCTGGG - Intergenic
984427718 4:179609001-179609023 TGCAGTGAGCCTCCCAGCCTGGG + Intergenic
984599023 4:181704991-181705013 TGCACTTGGCACTCCAGCCTGGG + Intergenic
985069802 4:186156914-186156936 GAAAGTGAGCACTCCATCCTGGG + Intronic
985251523 4:188028987-188029009 TGCAGGTTGCACTCCAGCCTGGG + Intergenic
985252452 4:188037713-188037735 TGCAATAAGCCCTCCAGCCTGGG + Intergenic
985584298 5:721060-721082 ATCACTGTGCACTCCAGCCTGGG + Intronic
985597803 5:805387-805409 ATCACTGTGCACTCCAGCCTGGG + Intronic
985792972 5:1941079-1941101 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
986114761 5:4761814-4761836 AACACTTAGGACTCCAGCCTGGG - Intergenic
986497860 5:8364688-8364710 TGCCGTGTGCACTCCAGTCTGGG + Intergenic
986940466 5:12942205-12942227 TACACTCAGCACTCCAGCCTGGG + Intergenic
987417864 5:17682938-17682960 TGCAGTAAGCACTCCAACCTGGG + Intergenic
987974186 5:24991274-24991296 GAGATTGTGCACTCCAGCCTGGG - Intergenic
988431985 5:31129817-31129839 TGCACTCTGCACTCCAGCCTGGG - Intergenic
988626033 5:32875980-32876002 GGCAGAGTGCACTCCAGCCTGGG - Intergenic
988807175 5:34751200-34751222 TGCAGTAAGCACTCCAGCCTGGG - Intronic
988824238 5:34918260-34918282 AGCCGTGAGCACTTCAGCCTGGG + Intronic
989059579 5:37397092-37397114 GACAGATGGCACTCCAGCCTGGG + Intronic
989672858 5:43938489-43938511 CACTGCAAGCACTCCAGCCTGGG + Intergenic
989847553 5:46164259-46164281 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
990049010 5:51471945-51471967 TACAGTGAGCACACCAGACCTGG - Intergenic
990183503 5:53188941-53188963 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
990856606 5:60274394-60274416 TGCACTCTGCACTCCAGCCTGGG - Intronic
990959999 5:61384203-61384225 TGCAGTCCGCAGTCCAGCCTAGG + Intronic
991118601 5:62984247-62984269 ACCACTGGGCACTCCAGCCTGGG - Intergenic
991338190 5:65574497-65574519 TACAGTCCGCAGTCCGGCCTGGG - Intronic
991669943 5:69037627-69037649 TGCAGTGAGCCGACCAGCCTGGG + Intergenic
992257719 5:74937932-74937954 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
992780230 5:80120767-80120789 TTCAGGCTGCACTCCAGCCTGGG + Intronic
993282210 5:85939043-85939065 TTCACTGAGCACTCCAGCCTGGG + Intergenic
993524442 5:88946728-88946750 TCCAGTTTGCACTCCAGCCCAGG + Intergenic
995179971 5:109221939-109221961 TGCTGTGATCACTACAGCCTGGG + Intergenic
995906266 5:117128091-117128113 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
996121540 5:119679503-119679525 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
996865026 5:128110681-128110703 TACAATGAGCTCTGCAGCCCTGG + Intronic
997066683 5:130568355-130568377 AAATTTGAGCACTCCAGCCTGGG + Intergenic
997141748 5:131388890-131388912 TGCAGTAAGCACTCCAGCCTGGG - Intronic
997162434 5:131623524-131623546 ACCATTGTGCACTCCAGCCTGGG - Intronic
997225117 5:132204105-132204127 GACAGTGAGGACTCCTGTCTTGG + Exonic
997288009 5:132697704-132697726 TACTCAGGGCACTCCAGCCTGGG + Intronic
998499955 5:142623784-142623806 TGCACTCTGCACTCCAGCCTGGG - Intronic
999173636 5:149616487-149616509 TAGAGTGAGGACTACAGCCCAGG + Intronic
999356346 5:150935876-150935898 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
999778157 5:154827499-154827521 CAAAGAGTGCACTCCAGCCTGGG - Intronic
999920529 5:156314537-156314559 TATAGTGTCTACTCCAGCCTAGG + Intronic
1000169735 5:158690400-158690422 AACAGGTTGCACTCCAGCCTGGG - Intergenic
1000175083 5:158744109-158744131 TGCAGTGAGCACTGCAGCCTGGG + Intronic
1000705344 5:164503711-164503733 GAGATTGGGCACTCCAGCCTGGG + Intergenic
1000827000 5:166057346-166057368 TACACTCCACACTCCAGCCTGGG + Intergenic
1002491461 5:179580772-179580794 TACAGAGAGAAAGCCAGCCTGGG - Intronic
1003044706 6:2723198-2723220 TGCAGTGATCACTTGAGCCTGGG + Intronic
1003052053 6:2788872-2788894 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1003442102 6:6152410-6152432 AACAGTAAGGACTCCATCCTTGG - Intronic
1003537007 6:6984014-6984036 CACTGTTAACACTCCAGCCTGGG + Intergenic
1003973055 6:11317371-11317393 AGCAGTGAGTACTCCAGCCTGGG + Intronic
1004156887 6:13177281-13177303 TAAAGTCTGCACTCCAGCCTGGG + Intronic
1004367997 6:15028226-15028248 TAAAGTAAGCATACCAGCCTGGG + Intergenic
1004373331 6:15071463-15071485 TTCATTTAGGACTCCAGCCTGGG - Intergenic
1004516094 6:16323480-16323502 TGCACTCTGCACTCCAGCCTGGG + Intronic
1004752574 6:18578555-18578577 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1004801684 6:19155469-19155491 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1005043044 6:21616502-21616524 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
1005580873 6:27233179-27233201 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1005748604 6:28863026-28863048 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1006237422 6:32646516-32646538 CACTGTGCTCACTCCAGCCTAGG + Intronic
1006402269 6:33824823-33824845 TACTCTGAGCCTTCCAGCCTAGG - Intergenic
1006495618 6:34421133-34421155 TAAAGTTGTCACTCCAGCCTGGG - Intronic
1006536272 6:34701452-34701474 CACACTGCACACTCCAGCCTGGG - Intergenic
1006698954 6:35956220-35956242 ACCAGTGCACACTCCAGCCTGGG + Intronic
1006882562 6:37353017-37353039 TCCAGGCTGCACTCCAGCCTGGG + Intergenic
1007048117 6:38798029-38798051 GACCGTGTCCACTCCAGCCTGGG + Intronic
1007670748 6:43551563-43551585 GCCACTGTGCACTCCAGCCTAGG - Intronic
1007795811 6:44346236-44346258 AACCGAGATCACTCCAGCCTGGG + Intronic
1007917135 6:45571774-45571796 CACTGTGCTCACTCCAGCCTGGG - Intronic
1008098663 6:47367724-47367746 GGCAGTGAGCACTCTAGCCTGGG + Intergenic
1008187317 6:48410027-48410049 TGCAGTGAGCTCTCCAGTCTGGG + Intergenic
1008394389 6:50990076-50990098 TGCAGTGAGCTATGCAGCCTGGG + Intergenic
1008752018 6:54746473-54746495 TGCAGTGAGCACTCCAGCCAGGG - Intergenic
1008757233 6:54810803-54810825 TGCACTATGCACTCCAGCCTGGG - Intergenic
1008809723 6:55481316-55481338 TGCAGTGAGCTATCCAGCCTGGG + Intronic
1008923352 6:56866027-56866049 TACACTCTGCACTCCAGCCTGGG - Intronic
1009027096 6:58013354-58013376 GACAGAGTGTACTCCAGCCTGGG - Intergenic
1009202641 6:60764830-60764852 GACAGAGTGTACTCCAGCCTGGG - Intergenic
1009638940 6:66305215-66305237 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1010942583 6:81936127-81936149 TGCAATGAGCACTCTAACCTGGG - Intergenic
1010972233 6:82275235-82275257 TACACTCCACACTCCAGCCTGGG + Intergenic
1011135056 6:84091287-84091309 TGCAGTGAGCCATCCAGCCTGGG - Intergenic
1011599401 6:89046013-89046035 ACCACTGTGCACTCCAGCCTGGG - Intergenic
1011632501 6:89340809-89340831 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1011658006 6:89568971-89568993 TGCAGTGAGCTCTCCTGCCTGGG - Intronic
1011725120 6:90203338-90203360 GAGGTTGAGCACTCCAGCCTGGG + Intronic
1012469766 6:99557744-99557766 TGAAGTGAGCACTCCAGCCTGGG + Intronic
1012904693 6:105050564-105050586 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1012930482 6:105311096-105311118 CACAGTCACCACTCTAGCCTGGG + Intronic
1013544718 6:111144885-111144907 TGCAATCAGCACTCCAGTCTAGG - Intronic
1013547259 6:111170488-111170510 GCCACTGCGCACTCCAGCCTGGG - Intronic
1014093806 6:117437318-117437340 TGCAGTGAGCACTCCAGCTTAGG + Intronic
1014229333 6:118885173-118885195 GAGACAGAGCACTCCAGCCTGGG + Intronic
1014464876 6:121743141-121743163 TACACACTGCACTCCAGCCTGGG - Intergenic
1015159348 6:130135119-130135141 TGCAGTGAGCACTCTAGCCCAGG - Intronic
1015291402 6:131541984-131542006 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1015494966 6:133871071-133871093 TGCGGTATGCACTCCAGCCTAGG + Intergenic
1015570169 6:134612776-134612798 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1015800906 6:137061348-137061370 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1016106732 6:140172372-140172394 AGCAGTGCACACTCCAGCCTGGG - Intergenic
1016238701 6:141902129-141902151 TGCAGTGAACACTCCAGCCTGGG - Intergenic
1016765731 6:147791245-147791267 GCCACTGTGCACTCCAGCCTAGG + Intergenic
1017088514 6:150737325-150737347 TGCACTCCGCACTCCAGCCTGGG - Intronic
1017136901 6:151155393-151155415 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
1017293917 6:152772551-152772573 TGCACTCCGCACTCCAGCCTGGG + Intergenic
1017609343 6:156168024-156168046 CACAGTGAGGTCCCCAGCCTAGG + Intergenic
1018006891 6:159630714-159630736 ACCAGTGCACACTCCAGCCTGGG + Intergenic
1018214788 6:161516424-161516446 ACCACTGTGCACTCCAGCCTGGG + Intronic
1018388521 6:163325988-163326010 TTCAGTGAGCACTCCAGCCTGGG + Intergenic
1019289651 7:243999-244021 TGCAGTGGTCACTGCAGCCTTGG + Intronic
1020082343 7:5293205-5293227 TGCACTCTGCACTCCAGCCTGGG - Intronic
1021247274 7:18279504-18279526 GCCACTGCGCACTCCAGCCTGGG - Intronic
1021652211 7:22843431-22843453 TGCAGTGAGCATTCCAGTCTGGG - Intergenic
1022684335 7:32581771-32581793 TGCAGTGAGCAGTCCAGCCTGGG + Intronic
1022700038 7:32751036-32751058 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1023098191 7:36684862-36684884 TGCAGTGAGCAGTTCACCCTGGG + Intronic
1023958905 7:44910648-44910670 TGCAGTGAGCACTCCAGCCTGGG + Intergenic
1024608118 7:51039373-51039395 TACAGTGAGGACCCATGCCTGGG - Intronic
1024674353 7:51624458-51624480 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1025065403 7:55850424-55850446 TACACCATGCACTCCAGCCTGGG + Intronic
1025704915 7:63854457-63854479 TCCACTGCACACTCCAGCCTGGG + Intergenic
1026006096 7:66601527-66601549 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1026231271 7:68486063-68486085 TACAGTGAATTCTCCAGTCTAGG - Intergenic
1026683827 7:72491182-72491204 TGCAGTGAGCCAACCAGCCTGGG + Intergenic
1026934862 7:74248540-74248562 ACCGTTGAGCACTCCAGCCTGGG - Intronic
1027035658 7:74923352-74923374 AACACTCTGCACTCCAGCCTGGG - Intergenic
1027152146 7:75740046-75740068 TACGATCTGCACTCCAGCCTGGG - Intergenic
1027384943 7:77650543-77650565 TCCACTGCACACTCCAGCCTGGG - Intergenic
1028440526 7:90854484-90854506 TACACCTTGCACTCCAGCCTGGG + Intronic
1028642528 7:93058946-93058968 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1028714154 7:93945310-93945332 TACACACTGCACTCCAGCCTGGG + Intergenic
1028735253 7:94204169-94204191 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1029222342 7:99000536-99000558 CACTCTGCGCACTCCAGCCTTGG + Intronic
1029456030 7:100673080-100673102 TTGAGATAGCACTCCAGCCTGGG + Intergenic
1030553128 7:110989485-110989507 TGTAGTGAGCACTCCAGCCTGGG + Intronic
1031141743 7:117950267-117950289 TGCAGTCTGCACTCCAGCCTGGG - Intergenic
1032014952 7:128373197-128373219 TGCACTCTGCACTCCAGCCTAGG + Intergenic
1032036350 7:128524477-128524499 TGCACTCTGCACTCCAGCCTGGG - Intergenic
1032105421 7:129024955-129024977 CACACTACGCACTCCAGCCTGGG + Intronic
1032131019 7:129227564-129227586 TGCAATGAGCACTCTAGCCTGGG + Intronic
1032413150 7:131714714-131714736 TGCCGTTGGCACTCCAGCCTGGG + Intergenic
1032611796 7:133423181-133423203 TGCAGTCCGCAGTCCAGCCTGGG + Intronic
1032684624 7:134220633-134220655 TAGAGGCTGCACTCCAGCCTGGG - Intronic
1033056694 7:138061477-138061499 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1034703967 7:153123775-153123797 TGCAGGGAGCACTCCAGCCTGGG - Intergenic
1034721243 7:153295201-153295223 AAAAGTGTGCACTCCAGCCTGGG - Intergenic
1035399000 7:158552466-158552488 TCCAGCCCGCACTCCAGCCTAGG - Intronic
1035445325 7:158937577-158937599 GATTGTGGGCACTCCAGCCTGGG + Intronic
1035620559 8:1033622-1033644 TACACTCTGCACTCCAGCCTGGG + Intergenic
1035724741 8:1817573-1817595 TACAGGGAACAGTACAGCCTGGG - Intergenic
1036169311 8:6467693-6467715 TCAAGTGATCCCTCCAGCCTTGG + Intronic
1036577320 8:10040305-10040327 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
1037190467 8:16118633-16118655 TACACCCCGCACTCCAGCCTGGG + Intronic
1037214630 8:16433824-16433846 AACAGATTGCACTCCAGCCTCGG + Intronic
1037594670 8:20344958-20344980 TACCATTTGCACTCCAGCCTGGG + Intergenic
1037868767 8:22471317-22471339 TACATCTATCACTCCAGCCTAGG - Intronic
1038015642 8:23512159-23512181 ACCAGTCTGCACTCCAGCCTGGG + Intergenic
1039063997 8:33593877-33593899 GGCAGTGAGCACTCTGGCCTAGG - Intronic
1039563748 8:38534310-38534332 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1039797647 8:40928877-40928899 TGCAGTGAGCACTCTAGCCTGGG - Intergenic
1039833478 8:41236618-41236640 TACTGCATGCACTCCAGCCTGGG - Intergenic
1040490448 8:47916386-47916408 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1040645504 8:49392003-49392025 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1040767364 8:50928996-50929018 TACTGTAAGAACCCCAGCCTTGG - Intergenic
1040785035 8:51155477-51155499 ACCACTGTGCACTCCAGCCTGGG + Intergenic
1041065758 8:54081491-54081513 TACAGGCTGCACTCCATCCTGGG - Intronic
1041924416 8:63221644-63221666 TCAAGCGTGCACTCCAGCCTGGG - Intergenic
1042326338 8:67532622-67532644 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1042637978 8:70900057-70900079 AAAAATGTGCACTCCAGCCTGGG + Intergenic
1042865387 8:73352282-73352304 TGCAGTGAGCACTCCAGACTAGG + Intergenic
1042907710 8:73789442-73789464 TCCACTGCACACTCCAGCCTGGG + Intronic
1043297139 8:78680242-78680264 TACAGTCCGCAGTCCGGCCTGGG + Intronic
1044234256 8:89812000-89812022 TGAAGTTCGCACTCCAGCCTGGG - Intergenic
1044990055 8:97787873-97787895 GCCAGTGCGCTCTCCAGCCTGGG - Intronic
1045271933 8:100669638-100669660 AAGAGTGAGCACTCCAGCCTGGG - Intergenic
1045389931 8:101705179-101705201 TGCAGTGAGCACTCCAGCCTGGG + Intronic
1045427960 8:102085709-102085731 GCCACTGTGCACTCCAGCCTGGG + Intronic
1045494070 8:102693598-102693620 AAGATTGAGCACTCCAGCATGGG - Intergenic
1045765605 8:105664382-105664404 GAGATTGTGCACTCCAGCCTGGG - Intronic
1045968490 8:108053857-108053879 AAGAGTTAGCACCCCAGCCTGGG + Intronic
1047092748 8:121591572-121591594 GAGATTGTGCACTCCAGCCTGGG + Intergenic
1048973518 8:139658248-139658270 CCCAGTGAGCACTGCAGCCAGGG + Intronic
1049055174 8:140230731-140230753 GCCACTGTGCACTCCAGCCTGGG + Intronic
1049177765 8:141204926-141204948 AACCTTGGGCACTCCAGCCTGGG + Intergenic
1049636782 8:143693321-143693343 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1049927693 9:425494-425516 TGCACTCTGCACTCCAGCCTGGG + Intronic
1050232731 9:3545009-3545031 TTCAGACTGCACTCCAGCCTGGG + Intergenic
1050760997 9:9070944-9070966 TACAGCCTGCACTCCAGCCCTGG - Intronic
1050765950 9:9134106-9134128 TGCAGTCCGCAGTCCAGCCTGGG - Intronic
1051288900 9:15525805-15525827 TACCCAAAGCACTCCAGCCTGGG - Intergenic
1051398214 9:16650030-16650052 TGCAGTCAGCACTCAACCCTGGG + Intronic
1053527377 9:38844023-38844045 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1053536795 9:38934320-38934342 TACAGAGTACACTCCAGCATAGG + Intergenic
1053928100 9:43087943-43087965 TACAGTCCGCAGTCCGGCCTGGG - Intergenic
1054629341 9:67429610-67429632 TACAGAGTACACTCCAGCATAGG - Intergenic
1054713287 9:68532652-68532674 AGCAGTGTGCACTCCAGCATGGG + Intergenic
1054775123 9:69118848-69118870 TGCACTGTGCACTCCAGCCTGGG - Intergenic
1055950287 9:81723998-81724020 TGCAGTCTGCACTCCAGCCTGGG - Intergenic
1056623484 9:88234853-88234875 TCCAGTGAGAATTCCAGCCAGGG - Intergenic
1057730973 9:97607842-97607864 TGTAGTGAGCATTCCAGCCTGGG + Intronic
1058463957 9:105209910-105209932 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1058658201 9:107244645-107244667 CACACTATGCACTCCAGCCTGGG - Intergenic
1058834247 9:108847361-108847383 TGCAGTGAGCACTCCAGCCTGGG - Intergenic
1059060445 9:111030443-111030465 TTCAGTGAGGACCCCCGCCTTGG - Intronic
1059106227 9:111514168-111514190 TGCAGGCTGCACTCCAGCCTCGG - Intergenic
1059318837 9:113450494-113450516 GACAGTGAGCACTACAGTCTAGG + Intronic
1059405485 9:114096368-114096390 AACTGTGAGTGCTCCAGCCTGGG - Exonic
1059521234 9:114944282-114944304 TGCAGTCCGCAGTCCAGCCTGGG - Intergenic
1059851197 9:118342224-118342246 AAAAGCCAGCACTCCAGCCTGGG - Intergenic
1061167616 9:128933195-128933217 TGCACTATGCACTCCAGCCTGGG - Intronic
1061316668 9:129800647-129800669 TGCACTCTGCACTCCAGCCTGGG + Intergenic
1061592377 9:131606207-131606229 TCCAGTGAGCACCCCCGGCTGGG + Intronic
1062026897 9:134344666-134344688 AGCAGTGAGAACTCCACCCTGGG - Intronic
1062689776 9:137835170-137835192 CAAAGTGTGCGCTCCAGCCTGGG - Exonic
1186121645 X:6369956-6369978 TGCAGTCTGCATTCCAGCCTGGG - Intergenic
1186427556 X:9475295-9475317 TGAGCTGAGCACTCCAGCCTGGG - Intronic
1186657079 X:11624609-11624631 TGCAGTGAGCACTCCGGCCTGGG - Intronic
1186884199 X:13896606-13896628 ACCACTGTGCACTCCAGCCTGGG - Intronic
1187084910 X:16031942-16031964 TGCAGTGTGCACTCCAGCCTGGG + Intergenic
1187163440 X:16784897-16784919 GCCATTGAACACTCCAGCCTGGG - Intergenic
1187465887 X:19527364-19527386 TGCAGGCTGCACTCCAGCCTGGG - Intergenic
1187912189 X:24121115-24121137 TCCAGCCTGCACTCCAGCCTGGG + Intergenic
1188065806 X:25658209-25658231 GAGATTGTGCACTCCAGCCTGGG - Intergenic
1188635715 X:32428653-32428675 TGCAGTCTCCACTCCAGCCTGGG - Intronic
1189169818 X:38898088-38898110 TGCAGTCCGCAGTCCAGCCTGGG + Intergenic
1189811741 X:44787399-44787421 TGCAGTAAGTACTCCAGCCTGGG + Intergenic
1190212479 X:48459473-48459495 TGGAGTGAGCACTCCCTCCTTGG + Intronic
1192109556 X:68350573-68350595 TGCAGTGAGCACTCTAGCCTAGG - Intronic
1192331442 X:70178478-70178500 TGCCGTTTGCACTCCAGCCTGGG - Intronic
1192750411 X:73984602-73984624 TGCACAGTGCACTCCAGCCTGGG - Intergenic
1193951437 X:87805083-87805105 TAAAGTGAGAACTCAAGCCATGG - Intergenic
1194518375 X:94887836-94887858 TACAGTGATCAATACAGGCTGGG + Intergenic
1194756866 X:97747972-97747994 TCCAGCCTGCACTCCAGCCTGGG - Intergenic
1195244703 X:102984990-102985012 CACAGCATGCACTCCAGCCTGGG - Intergenic
1196210815 X:112993966-112993988 TGCAGTGAGCATTACAGCCTTGG - Intergenic
1196807357 X:119600333-119600355 CACAGGCTGCACTCCAGCCTTGG + Intronic
1197214612 X:123856432-123856454 TGCCATTAGCACTCCAGCCTGGG + Intergenic
1197229138 X:123984687-123984709 AACTGAGATCACTCCAGCCTCGG - Intronic
1197857679 X:130934049-130934071 GCTGGTGAGCACTCCAGCCTGGG + Intergenic
1198307152 X:135394469-135394491 GAGATTGTGCACTCCAGCCTGGG + Intergenic
1198436175 X:136618851-136618873 TATAGTGAGAAATCCTGCCTGGG - Intergenic
1199769075 X:150962475-150962497 GAGATCGAGCACTCCAGCCTGGG + Intergenic
1199927689 X:152485099-152485121 TGCAGTGAGCCGACCAGCCTGGG + Intergenic
1200783884 Y:7241597-7241619 TACAGGCTGCACTCCAGCCTGGG + Intergenic
1200822623 Y:7602615-7602637 TACAACATGCACTCCAGCCTGGG + Intergenic
1201314893 Y:12634201-12634223 TGCACTGAGCACTCCAGCAAGGG + Intergenic
1201747158 Y:17389651-17389673 TACCATTTGCACTCCAGCCTGGG - Intergenic
1202047802 Y:20751948-20751970 TATATTGTGAACTCCAGCCTGGG - Intergenic
1202237680 Y:22731402-22731424 TACAACATGCACTCCAGCCTGGG - Intergenic