ID: 1127573046

View in Genome Browser
Species Human (GRCh38)
Location 15:60262800-60262822
Sequence GTACAGTGAGCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127573046_1127573047 -3 Left 1127573046 15:60262800-60262822 CCAGGCTGGAGTGCTCACTGTAC No data
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data
1127573046_1127573054 30 Left 1127573046 15:60262800-60262822 CCAGGCTGGAGTGCTCACTGTAC No data
Right 1127573054 15:60262853-60262875 ACCTCAGCCTCCTGAGTACGAGG 0: 7
1: 553
2: 17564
3: 127382
4: 231400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127573046 Original CRISPR GTACAGTGAGCACTCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr