ID: 1127573047

View in Genome Browser
Species Human (GRCh38)
Location 15:60262820-60262842
Sequence TACCTTGACCTCCCAGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127573045_1127573047 -2 Left 1127573045 15:60262799-60262821 CCCAGGCTGGAGTGCTCACTGTA 0: 5
1: 41
2: 54
3: 89
4: 700
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data
1127573046_1127573047 -3 Left 1127573046 15:60262800-60262822 CCAGGCTGGAGTGCTCACTGTAC No data
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data
1127573043_1127573047 4 Left 1127573043 15:60262793-60262815 CCCTCGCCCAGGCTGGAGTGCTC No data
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data
1127573044_1127573047 3 Left 1127573044 15:60262794-60262816 CCTCGCCCAGGCTGGAGTGCTCA No data
Right 1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127573047 Original CRISPR TACCTTGACCTCCCAGACTC AGG Intergenic
No off target data available for this crispr