ID: 1127574833

View in Genome Browser
Species Human (GRCh38)
Location 15:60281199-60281221
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127574833_1127574836 -7 Left 1127574833 15:60281199-60281221 CCCATTTTATTACAATTCCACAG No data
Right 1127574836 15:60281215-60281237 TCCACAGGCAGCTAGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127574833 Original CRISPR CTGTGGAATTGTAATAAAAT GGG (reversed) Intergenic
No off target data available for this crispr