ID: 1127577184

View in Genome Browser
Species Human (GRCh38)
Location 15:60303292-60303314
Sequence AAGGATGCTGAAGTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127577184_1127577191 15 Left 1127577184 15:60303292-60303314 CCATGCCCAACTTCAGCATCCTT No data
Right 1127577191 15:60303330-60303352 ACATTCTCACACCAGAGGCAGGG No data
1127577184_1127577189 10 Left 1127577184 15:60303292-60303314 CCATGCCCAACTTCAGCATCCTT No data
Right 1127577189 15:60303325-60303347 GTTGGACATTCTCACACCAGAGG No data
1127577184_1127577190 14 Left 1127577184 15:60303292-60303314 CCATGCCCAACTTCAGCATCCTT No data
Right 1127577190 15:60303329-60303351 GACATTCTCACACCAGAGGCAGG No data
1127577184_1127577187 -8 Left 1127577184 15:60303292-60303314 CCATGCCCAACTTCAGCATCCTT No data
Right 1127577187 15:60303307-60303329 GCATCCTTTTGAATATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127577184 Original CRISPR AAGGATGCTGAAGTTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr