ID: 1127577631

View in Genome Browser
Species Human (GRCh38)
Location 15:60307511-60307533
Sequence TGAGCCCACTGGAGGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127577626_1127577631 10 Left 1127577626 15:60307478-60307500 CCACTTCCAGAAATATCTGGTAT No data
Right 1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG No data
1127577627_1127577631 4 Left 1127577627 15:60307484-60307506 CCAGAAATATCTGGTATCACCAA No data
Right 1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG No data
1127577624_1127577631 23 Left 1127577624 15:60307465-60307487 CCTACATTCACTGCCACTTCCAG No data
Right 1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127577631 Original CRISPR TGAGCCCACTGGAGGTTTTG AGG Intergenic
No off target data available for this crispr