ID: 1127577651

View in Genome Browser
Species Human (GRCh38)
Location 15:60307705-60307727
Sequence AAATGAAATCTACAGCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127577647_1127577651 23 Left 1127577647 15:60307659-60307681 CCATAAATGTTTGCGGAATGTTG No data
Right 1127577651 15:60307705-60307727 AAATGAAATCTACAGCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127577651 Original CRISPR AAATGAAATCTACAGCTTAA GGG Intergenic
No off target data available for this crispr