ID: 1127578901

View in Genome Browser
Species Human (GRCh38)
Location 15:60318826-60318848
Sequence CTTTCAACTCTAATGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127578901_1127578905 27 Left 1127578901 15:60318826-60318848 CCTCCCACCATTAGAGTTGAAAG No data
Right 1127578905 15:60318876-60318898 ATTAACACCCGATTTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127578901 Original CRISPR CTTTCAACTCTAATGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr