ID: 1127578905

View in Genome Browser
Species Human (GRCh38)
Location 15:60318876-60318898
Sequence ATTAACACCCGATTTTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127578903_1127578905 23 Left 1127578903 15:60318830-60318852 CCACCATTAGAGTTGAAAGCTGC No data
Right 1127578905 15:60318876-60318898 ATTAACACCCGATTTTAAAATGG No data
1127578902_1127578905 24 Left 1127578902 15:60318829-60318851 CCCACCATTAGAGTTGAAAGCTG No data
Right 1127578905 15:60318876-60318898 ATTAACACCCGATTTTAAAATGG No data
1127578904_1127578905 20 Left 1127578904 15:60318833-60318855 CCATTAGAGTTGAAAGCTGCTAA No data
Right 1127578905 15:60318876-60318898 ATTAACACCCGATTTTAAAATGG No data
1127578901_1127578905 27 Left 1127578901 15:60318826-60318848 CCTCCCACCATTAGAGTTGAAAG No data
Right 1127578905 15:60318876-60318898 ATTAACACCCGATTTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127578905 Original CRISPR ATTAACACCCGATTTTAAAA TGG Intergenic
No off target data available for this crispr