ID: 1127581315

View in Genome Browser
Species Human (GRCh38)
Location 15:60341615-60341637
Sequence CACATCCCACGATGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127581315_1127581321 6 Left 1127581315 15:60341615-60341637 CCAGCTTCCCATCGTGGGATGTG No data
Right 1127581321 15:60341644-60341666 TCTGGTAATGCGAGAAGAAATGG No data
1127581315_1127581322 28 Left 1127581315 15:60341615-60341637 CCAGCTTCCCATCGTGGGATGTG No data
Right 1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127581315 Original CRISPR CACATCCCACGATGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr