ID: 1127581318

View in Genome Browser
Species Human (GRCh38)
Location 15:60341622-60341644
Sequence AACAGCCCACATCCCACGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127581318_1127581321 -1 Left 1127581318 15:60341622-60341644 CCCATCGTGGGATGTGGGCTGTT No data
Right 1127581321 15:60341644-60341666 TCTGGTAATGCGAGAAGAAATGG No data
1127581318_1127581322 21 Left 1127581318 15:60341622-60341644 CCCATCGTGGGATGTGGGCTGTT No data
Right 1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG No data
1127581318_1127581323 29 Left 1127581318 15:60341622-60341644 CCCATCGTGGGATGTGGGCTGTT No data
Right 1127581323 15:60341674-60341696 TCAGACTGAGATTGGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127581318 Original CRISPR AACAGCCCACATCCCACGAT GGG (reversed) Intergenic
No off target data available for this crispr